GSG1 (NM_001080555) Human Untagged Clone

CAT#: SC315743

GSG1 (untagged)-Human germ cell associated 1 (GSG1), transcript variant 4


  "NM_001080555" in other vectors (4)

Reconstitution Protocol

USD 610.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GSG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSG1
Synonyms MGC3146; MGC111023
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001080555, the custom clone sequence may differ by one or more nucleotides


ATGAGCGATCCCTCTCAACTGACTCAAAATGTTTGCCTCACCCAGGAGATGGAGCTCTCGAAGGCCTTCT
CTGGCCAGCGGACACTCCTATCTGCCATCCTCAGCATGCTATCACTCAGCTTCTCCACAACATCCCTGCT
CAGCAACTACTGGTTTGTGGGCACACAGAAGGTGCCCAAGCCCCTGTGCGAGAAAGGTCTGGCAGCCAAG
TGCTTTGACATGCCAGTGTCCCTGGATGGAGATACCAACACATCCACCCAGGAGGTGGTACAATACAACT
GGGAGACTGGGGATGACCGGTTCTCCTTCCGGAGCTTCCGGAGTGGCATGTGGCTATCCTGTGAGGAAAC
TGTGGAAGAACCAGCACTGCTCCATCCCCAGTCCTGGAAACAATTTAGAGCCCTTCGGTCCAGTGGTACA
GCGGCAGCAAAAGGGGAGAGGTGCCGAAGTTTCATTGAACTTACACCACCAGCCAAGAGAGAAATCCTAT
GGTTATCCCTGGGAACGCAGATCACCTACATCGGACTTCAATTCATCAGCTTCCTCCTGCTACTAACAGA
CTTGCTACTCACTGGGAACCCTGCCTGTGGGCTCAAACTGAGCGCCTTTGCTGCTGTTTCCTCTGTCCTG
TCAGGTCTCCTGGGGATGGTGGCCCACATGATGTATTCACAAGTCTTCCAAGCGACTGTCAACTTGGGTC
CAGAAGACTGGAGACCACATGTTTGGAATTATGGCTGGGCCTTCTACATGGCCTGGCTCTCCTTCACCTG
CTGCATGGCGTCGGCTGTCACCACCTTCAACACGTACACCAGGATGGTGCTGGAGTTCAAGTGCAAGCAT
AGTAAGAGCTTCAAGGAAAACCCGAACTGCCTACCACATCACCATCAGTGTTTCCCTCGGCGGCTGTCAA
GTGCAGCCCCCACCGTGGGTCCTTTGACCAGCTACCACCAGTATCATAATCAGCCCATCCACTCTGTCTC
TGAGGGAGTCGACTTCTACTCCGAGCTGCGGAACAAGGGATTTCAAAGAGGGGCCAGCCAGGAGCTGAAA
GAAGCAGTTAGGTCATCTGTAGAGGAAGAGCAGTGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001080555
ORF Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001080555.2, NP_001074024.1
RefSeq Size 2637
RefSeq ORF 1089
Locus ID 83445
Protein Families Transmembrane
Gene Summary May cause the redistribution of PAPOLB from the cytosol to the endoplasmic reticulum. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, includes an alternate in-frame exon in the central coding region, and uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (4) has distinct N- and C-termini and is longer than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.