NXF1 (NM_001081491) Human Untagged Clone

CAT#: SC315942

NXF1 (untagged)-Human nuclear RNA export factor 1 (NXF1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NXF1
• Synonyms: MEX67; TAP
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001081491 edited
  ATGGCGGACGAGGGGAAGTCGTACAGCGAACACGATGATGAACGCGTTAATTTCCCTCAA
  AGAAAGAAGAAAGGCCGGGGTCCCTTCCGGTGGAAATATGGTGAAGGAAACCGTAGGTCT
  GGAAGAGGCGGTTCTGGTATTCGGTCTTCCCGCCTTGAGGAAGATGATGGAGATGTGGCA
  ATGAGTGATGCCCAGGATGGTCCCCGAGTACGATACAACCCCTATACCACCCGACCTAAC
  CGTCGGGGTGATACTTGGCATGATCGAGATCGCATTCATGTTACTGTGCGGAGAGACAGA
  GCTCCTCCAGAGAGAGGAGGGGCTGGCACCAGCCAGGATGGGACCTCAAAGAACTGGTTC
  AAGATTACAATTCCTTATGGCAGAAAGTATGACAAGGCATGGCTCCTGAGCATGATTCAG
  AGCAAGTGCAGTGTGCCCTTCACCCCTATTGAGTTTCACTATGAGAATACACGGGCCCAG
  TTCTTCGTTGAAGACGCCAGTACTGCCTCTGCATTGAAGGCTGTCAACTATAAGATTTTG
  GATCGGGAGAACCGAAGGATATCTATCATCATCAACTCTTCTGCTCCACCCCACACTATA
  CTGAATGAACTGAAGCCAGAACAAGTAGAACAGCTAAAGCTGATCATGAGCAAACGATAC
  GATGGCTCCCAACAAGCCCTTGACCTCAAAGGCCTCCGTTCAGACCCAGATTTGGTGGCC
  CAGAACATTGACGTTGTCCTGAATCGCAGAAGCTGTATGGCAGCTACCCTGAGGATCATT
  GAAGAGAACATCCCTGAGCTATTGTCCTTGAACTTGAGCAACAACAGGCTGTACAGGCTG
  GATGACATGTCTAGCATTGTTCAGAAGGCACCCAACCTGAAGATCCTAAACCTTTCTGGA
  AATGAATTGAAGTCTGAGCGGGAATTGGACAAGATAAAGGGGCTGAAGCTAGAAGAGCTC
  TGGCTCGATGGAAACTCCCTGTGTGACACCTTCCGAGACCAGTCCACCTACATCAGGTCA
  GTTGTAGCCTGTGTCTCCCCTCCTGGGGACCTTCACCCCCTGGGAGGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001081491
• ORF Size: 1071 bp
• Insert Size: 4000
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001081491.1, NP_001074960.1
• RefSeq Size: 4147
• RefSeq ORF: 1071
• Locus ID: 10482
• Gene Summary: This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) includes an alternate segment, compared to variant 1, resulting in a shorter protein (isoform 2) that has a distinct C-terminus, compared to isoform 1. CCDS Note: This CCDS ID represents the protein described in PMID: 16971948. This transcript is supported by AB209915.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 16971948. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.