zinc finger protein 655 (ZNF655) (NM_001085367) Human Untagged Clone

CAT#: SC316150

ZNF655 (untagged)-Human zinc finger protein 655 (ZNF655), transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF655
• Synonyms: VIK; VIK-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001085367, the custom clone sequence may differ by one or more nucleotides
  ATGGAGGAAATACCAGCCCAGGAAGCAGCAGGGTCACCAAGGGTCCAGTTTCAGTCTTTG
  GAGACCCAGTCTGAGTGTCTGTCCCCAGAGCCTCAGTTTGTGCAGGACACCGACATGGAA
  CAGGGACTCACTGGGGCTCCACCTGTTCCTCAGGTGCCTGCTCTTCCCCGTGAGGGAAGC
  CCAGGAGACCAGGCAGCTGCGCTCTTGACAGCCAGGTACCAGGAGTTTGTGACATTCGAG
  GATGTGGCTGTGCACCTTACTCGAGAGGAATGGGGATACCTGGACCCTGTTCAGAGGGAC
  CTCTACAGAGAAGTGATGTTAGAGAATTATGGGAACGTGGTCTCACTGGGCATACTTCTC
  CGCCTTCCCACCACCCGGATTCATAGTGTGAATTCCTGCCCGGCCCTGAGTCATACCCAG
  GCAAGTGCTTTCTCTGGAGAAACACTTGCCGTCCTTACAGCAGGAATCTCCAAGAGATGG
  CCCAAGTATCGGCTTCCCATCGATATTGCTCGTCCCTGCTCGGAAACTCCTTTTCCACGA
  TTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001085367
• ORF Size: 546 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001085367.1, NP_001078836.1
• RefSeq Size: 1435
• RefSeq ORF: 546
• Locus ID: 79027
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (10) has a distinct 5' UTR and includes alternate exons in the 3' coding region and 3' UTR, compared to variant 7. Both variants 2 and 10 encode the same isoform (b), which has a shorter and distinct C-terminus compared to isoform f.