GNG4 (NM_001098722) Human Untagged Clone

CAT#: SC316325

GNG4 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 1


  "NM_001098722" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GNG4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GNG4
Synonyms DKFZp547K1018; FLJ23803; FLJ34187
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001098722, the custom clone sequence may differ by one or more nucleotides


ATGAAAGAGGGCATGTCTAATAACAGCACCACTAGCATCTCCCAAGCCAGGAAAGCTGTGGAGCAGCTAA
AGATGGAAGCCTGTATGGACAGGGTCAAGGTCTCCCAGGCAGCTGCGGACCTCCTGGCCTACTGTGAAGC
TCACGTGCGGGAAGATCCTCTCATCATTCCAGTGCCTGCATCAGAAAACCCCTTTCGCGAGAAGAAGTTC
TTTTGTACCATTCTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001098722
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098722.1, NP_001092192.1
RefSeq Size 5123 bp
RefSeq ORF 228 bp
Locus ID 2786
Cytogenetics 1q42.3
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Gene Summary ''
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.