Tcl1 (TCL1A) (NM_001098725) Human Untagged Clone

CAT#: SC316327

TCL1A (untagged)-Human T-cell leukemia/lymphoma 1A (TCL1A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TCL1A
• Synonyms: TCL1
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001098725 edited
  ATGGCCGAGTGCCCGACACTCGGGGAGGCAGTCACCGACCACCCGGACCGCCTGTGGGCC
  TGGGAGAAGTTCGTGTATTTGGACGAGAAGCAGCACGCCTGGCTGCCCTTAACCATCGAG
  ATAAAGGATAGGTTACAGTTACGGGTGCTCTTGCGTCGGGAAGACGTCGTCCTGGGGAGG
  CCTATGACCCCCACCCAGATAGGCCCAAGCCTGCTGCCTATCATGTGGCAGCTCTACCCT
  GATGGACGATACCGATCCTCAGACTCCAGTTTCTGGCGCTTAGTGTACCACATCAAGATT
  GACGGCGTGGAGGACATGCTTCTCGAGCTGCTGCCAGATGACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001098725
• ORF Size: 345 bp
• Insert Size: 350
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001098725.1, NP_001092195.1
• RefSeq Size: 1405
• RefSeq ORF: 345
• Locus ID: 8115
• Protein Families: Druggable Genome
• Gene Summary: Overexpression of the TCL1 gene in humans has been implicated in the development of mature T cell leukemia, in which chromosomal rearrangements bring the TCL1 gene in close proximity to the T-cell antigen receptor (TCR)-alpha (MIM 186880) or TCR-beta (MIM 186930) regulatory elements (summarized by Virgilio et al., 1998 [PubMed 9520462]). In normal T cells TCL1 is expressed in CD4-/CD8- cells, but not in cells at later stages of differentiation. TCL1 functions as a coactivator of the cell survival kinase AKT (MIM 164730) (Laine et al., 2000 [PubMed 10983986]). [supplied by OMIM, Jul 2010]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.