PRAS40 (AKT1S1) (NM_001098633) Human Untagged Clone

CAT#: SC316352

AKT1S1 (untagged)-Human AKT1 substrate 1 (proline-rich) (AKT1S1), transcript variant 3


  "NM_001098633" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AKT1S1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AKT1S1
Synonyms Lobe; PRAS40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001098633, the custom clone sequence may differ by one or more nucleotides


ATGGCGTCGGGGCGCCCCGAGGAGCTGTGGGAGGCCGTGGTGGGGGCCGCTGAGCGCTTCCGGGCCCGGA
CTGGCACGGAGCTGGTGCTGCTGACCGCGGCCCCGCCGCCACCACCCCGCCCGGGCCCCTGTGCCTATGC
TGCCCATGGTCGAGGAGCCCTGGCGGAGGCAGCGCGCCGTTGCCTCCACGACATCGCACTGGCCCACAGG
GCTGCCACTGCTGCTCGGCCTCCTGCGCCCCCACCAGCACCACAGCCACCCAGTCCCACACCCAGCCCAC
CCCGGCCTACCCTGGCCAGAGAGGACAACGAGGAGGACGAGGATGAGCCCACAGAGACAGAGACCTCCGG
GGAGCAGCTGGGCATTAGTGATAATGGAGGGCTCTTTGTGATGGATGAGGACGCCACCCTCCAGGACCTT
CCCCCCTTCTGTGAGTCAGACCCCGAGAGTACAGATGATGGCAGCCTGAGCGAGGAGACCCCCGCCGGCC
CCCCCACCTGCTCAGTGCCCCCAGCCTCAGCCCTACCCACACAGCAGTACGCCAAGTCCCTGCCTGTGTC
TGTGCCCGTCTGGGGCTTCAAGGAGAAGAGGACAGAGGCGCGGTCATCAGATGAGGAGAATGGGCCGCCC
TCTTCGCCCGACCTGGACCGCATCGCGGCGAGCATGCGCGCGCTGGTGCTGCGAGAGGCCGAGGACACCC
AGGTCTTCGGGGACCTGCCACGGCCGCGGCTTAACACCAGCGACTTCCAGAAGCTGAAGCGGAAATATTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001098633
ORF Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001098633.3, NP_001092103.1
RefSeq Size 1813
RefSeq ORF 771
Locus ID 84335
Gene Summary AKT1S1 is a proline-rich substrate of AKT (MIM 164730) that binds 14-3-3 protein (see YWHAH, MIM 113508) when phosphorylated (Kovacina et al., 2003 [PubMed 12524439]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, 4, and 5 encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.