KDELR2 (NM_001100603) Human Untagged Clone

CAT#: SC316671

KDELR2 (untagged)-Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KDELR2
• Synonyms: ELP-1; ERD2.2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001100603, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACATTTTCCGGCTGACTGGGGACCTGTCCCACCTGGCGGCCATCGTCATCCTGCTGCTGAAGATCT
  GGAAGACGCGCTCCTGCGCCGGTATTTCTGGGAAAAGCCAGCTTCTGTTTGCACTGGTCTTCACAACTCG
  TTACCTGGATCTTTTTACTTCATTTATTTCATTGTATAACACATCTATGAAGGTTATCTACCTTGCCTGC
  TCCTATGCCACAGTGTACCTGATCTACCTGAAATTTAAGGCAACCTACGATGGAAATCATGATACCTTCC
  GAGTGGAGTTTCTGGTGGTCCCTGTGGGAGGCCTCTCATTTTTAGTTAATCACGATTTCTCTCCTCTTGA
  GTACTCAAGGGAAAGAAGCTCAGTTTGCCAGCATAAGTGCCAAAGACCATCACCAGCATCTGTCCTTCAG
  GGTGCTCGGACAGAATTCTTACCACAGCAAAGGCATAAGATGCTTGATACGGAAAATCAGAAACTTAACT
  CTTTTGTTGCAGATAGTCATCAGTGGCTCTGTAAAAACGCAGAGGAAAAGAGCCAGAAGGTTTCTGTTTA
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001100603
• ORF Size: 561 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001100603.1, NP_001094073.1
• RefSeq Size: 2621
• RefSeq ORF: 561
• Locus ID: 11014
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Vibrio cholerae infection
• Gene Summary: Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a longer and distinct C-terminus, compared to isoform 1.