ULBP4 (RAET1E) (NM_139165) Human Untagged Clone

CAT#: SC316696

RAET1E (untagged)-Human retinoic acid early transcript 1E (RAET1E)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAET1E
• Synonyms: bA350J20.7; LETAL; N2DL-4; NKG2DL4; RAET1E2; RL-4; ULBP4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_139165, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGAAGAATATCCCTGACTTCTAGCCCTGTGCGCCTTCTTTTGTTTCTGCTGTTGCTACTAATAGCCT
  TGGAGATCATGGTTGGTGGTCACTCTCTTTGCTTCAACTTCACTATAAAATCATTGTCCAGACCTGGACA
  GCCCTGGTGTGAAGCGCAGGTCTTCTTGAATAAAAATCTTTTCCTTCAGTACAACAGTGACAACAACATG
  GTCAAACCTCTGGGCCTCCTGGGGAAGAAGGTATATGCCACCAGCACTTGGGGAGAATTGACCCAAACGC
  TGGGAGAAGTGGGGCGAGACCTCAGGATGCTCCTTTGTGACATCAAACCCCAGATAAAGACCAGTGATCC
  TTCCACTCTGCAAGTCGAGATGTTTTGTCAACGTGAAGCAGAACGGTGCACTGGTGCATCCTGGCAGTTC
  GCCACCAATGGAGAGAAATCCCTCCTCTTTGACGCAATGAACATGACCTGGACAGTAATTAATCATGAAG
  CCAGTAAGATCAAGGAGACATGGAAGAAAGACAGAGGGCTGGAAAAGTATTTCAGGAAGCTCTCAAAGGG
  AGACTGCGATCACTGGCTCAGGGAATTCTTAGGGCACTGGGAGGCAATGCCAGAACCGACAGTGTCACCA
  GTAAATGCTTCAGATATCCACTGGTCTTCTTCTAGTCTACCAGATAGATGGATCATCCTGGGGGCATTCA
  TCCTGTTAGTTTTAATGGGAATTGTTCTCATCTGTGTCTGGTGGCAAAATGGTGAGTGGCAGGCTGGTCT
  CTGGCCCTTGAGGACGTCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_139165
• ORF Size: 792 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_139165.2, NP_631904.1
• RefSeq Size: 958
• RefSeq ORF: 792
• Locus ID: 135250
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Natural killer cell mediated cytotoxicity
• Gene Summary: This gene belong to the RAET1 family, which consists of major histocompatibility complex (MHC) class I-related genes located in a cluster on chromosome 6q24.2-q25.3. This and RAET1G protein differ from other RAET1 proteins in that they have type I membrane-spanning sequences at their C termini rather than glycosylphosphatidylinositol anchor sequences. This protein functions as a ligand for NKG2D receptor, which is expressed on the surface of several types of immune cells, and is involved in innate and adaptive immune responses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (1) encodes the longest isoform (1).