RNASE9 (NM_001110357) Human Untagged Clone
CAT#: SC317185
RNASE9 (untagged)-Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 6
"NM_001110357" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RNASE9 |
Synonyms | h461; HEL128; RAK1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001110357, the custom clone sequence may differ by one or more nucleotides
ATGATGAGAACTCTCATCACCACACACCCACTGCCCCTGCTTCTATTGCCGCAGCAGCTGCTGCAGCTGG TGCAGTTTCAAGAGGTGGATACAGATTTTGATTTCCCAGAAGAAGATAAAAAAGAAGAATTTGAAGAGTG TTTGGAAAAATTTTTTAGTACAGGGCCCGCCAGACCACCTACCAAAGAAAAAGTCAAAAGACGTGTCCTT ATTGAACCTGGAATGCCACTAAATCATATAGAGTACTGTAACCATGAAATCATGGGAAAAAATGTTTACT ACAAACACCGTTGGGTGGCAGAACATTACTTCCTTCTTATGCAATATGACGAGCTCCAAAAAATCTGTTA CAACAGATTTGTGCCATGTAAGAATGGAATTAGGAAATGTAACAGGAGCAAAGGTCTTGTAGAAGGAGTG TATTGTAATTTAACAGAAGCATTTGAAATACCAGCGTGTAAATACGAATCACTTTATAGGAAGGGCTACG TCCTTATCACTTGTTCATGGCAAAATGAAATGCAAAAACGTATTCCTCATACTATAAATGATCTCGTGGA GCCACCTGAACACAGAAGTTTCCTCAGTGAGGATGGTGTCTTTGTCATATCGCCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001110357 |
ORF Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001110357.1, NP_001103827.1 |
RefSeq Size | 1103 |
RefSeq ORF | 618 |
Locus ID | 390443 |
Protein Families | Secreted Protein |
Gene Summary | Does not exhibit any ribonuclease activity. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6, also known as alpha1) lacks two alternate exons in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 5, 6, 7, and 8 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225234 | RNASE9 (Myc-DDK-tagged)-Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 6 |
USD 420.00 |
|
RG225234 | RNASE9 (GFP-tagged) - Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 6 |
USD 460.00 |
|
RC225234L3 | Lenti ORF clone of Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 6, Myc-DDK-tagged |
USD 620.00 |
|
RC225234L4 | Lenti ORF clone of Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 6, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review