RNASE9 (NM_001110361) Human Untagged Clone

CAT#: SC317189

RNASE9 (untagged)-Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 2


  "NM_001110361" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNASE9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNASE9
Synonyms h461; HEL128; RAK1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001110361, the custom clone sequence may differ by one or more nucleotides
ATGTCTGCAGGAAAAATGATGAGAACTCTCATCACCACACACCCACTGCCCCTGCTTCTA
TTGCCGCAGCAGCTGCTGCAGCTGGTGCAGTTTCAAGAGGTGGATACAGATTTTGATTTC
CCAGAAGAAGATAAAAAAGAAGAATTTGAAGAGTGTTTGGAAAAATTTTTTAGTACAGGG
CCCGCCAGACCACCTACCAAAGAAAAAGTCAAAAGACGTGTCCTTATTGAACCTGGAATG
CCACTAAATCATATAGAGTACTGTAACCATGAAATCATGGGAAAAAATGTTTACTACAAA
CACCGTTGGGTGGCAGAACATTACTTCCTTCTTATGCAATATGACGAGCTCCAAAAAATC
TGTTACAACAGATTTGTGCCATGTAAGAATGGAATTAGGAAATGTAACAGGAGCAAAGGT
CTTGTAGAAGGAGTGTATTGTAATTTAACAGAAGCATTTGAAATACCAGCGTGTAAATAC
GAATCACTTTATAGGAAGGGCTACGTCCTTATCACTTGTTCATGGCAAAATGAAATGCAA
AAACGTATTCCTCATACTATAAATGATCTCGTGGAGCCACCTGAACACAGAAGTTTCCTC
AGTGAGGATGGTGTCTTTGTCATATCGCCC
Restriction Sites Please inquire     
ACCN NM_001110361
ORF Size 633 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001110361.1, NP_001103831.1
RefSeq Size 1191
RefSeq ORF 633
Locus ID 390443
Protein Families Secreted Protein
Gene Summary Does not exhibit any ribonuclease activity. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2, also known as alpha123) uses an alternate splice site in the 5' coding region, compared to variant 1. Variants 1, 2, 3, and 4 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.