PCBD2 (NM_032151) Human Untagged Clone

CAT#: SC317230

PCBD2 (untagged)-Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 (PCBD2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PCBD2
• Synonyms: DCOH2; DCOHM; PHS2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032151, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGTGCTCGGGGCGCTCGGGGCGACGCGGCGCTTGTTGGCGGCGCTGCGAGGCCAGAGCCTAG
  GGCTAGCGGCCATGTCATCAGGTACTCACAGGTTGACTGCAGAGGAGAGGAACCAAGCTATACTTGACCT
  TAAAGCAGCAGGATGGTCGGAATTAAGTGAGAGAGATGCCATCTACAAAGAATTCTCCTTCCACAATTTT
  AATCAGGCATTTGGCTTTATGTCCCGAGTTGCCCTACAAGCAGAGAAGATGAATCATCACCCAGAATGGT
  TCAATGTATACAACAAGGTCCAGATAACTCTCACCTCACATGACTGTGGTGAACTGACCAAAAAAGATGT
  GAAGCTGGCCAAGTTTATTGAAAAAGCAGCTGCTTCTGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_032151
• ORF Size: 393 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032151.4, NP_115527.3
• RefSeq Size: 2395
• RefSeq ORF: 393
• Locus ID: 84105
• Domains: Pterin_4a
• Protein Families: Druggable Genome, Transcription Factors