GNLY (NM_012483) Human Untagged Clone

CAT#: SC317232

GNLY (untagged)-Human granulysin (GNLY), transcript variant 519

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNLY
• Synonyms: D2S69E; LAG-2; LAG2; NKG5; TLA519
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_012483, the custom clone sequence may differ by one or more nucleotides
  ATGGAAGGTCTGGTCTTCTCTCGTCTGAGCCCTGAGTACTACGACCTGGCAAGAGCCCAC
  CTGCGTGATGAGGAGAAATCCTGCCCGTGCCTGGCCCAGGAGGGCCCCCAGGGTGACCTG
  TTGACCAAAACACAGGAGCTGGGCCGTGACTACAGGACCTGTCTGACGATAGTCCAAAAA
  CTGAAGAAGATGGTGGATAAGCCCACCCAGAGAAGTGTTTCCAATGCTGCGACCCGGGTG
  TGTAGGACGGGGAGGTCACGATGGCGCGACGTCTGCAGAAATTTCATGAGGAGGTATCAG
  TCTAGAGTTACCCAGGGCCTCGTGGCCGGAGAAACTGCCCAGCAGATCTGTGAGGACCTC
  AGGTTGTGTATACCTTCTACAGGTCCCCTC
  
• Restriction Sites: Please inquire
• ACCN: NM_012483
• ORF Size: 393 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_012483.2, NP_036615.2
• RefSeq Size: 995
• RefSeq ORF: 393
• Locus ID: 10578
• Protein Families: Secreted Protein
• Gene Summary: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) uses an alternate splice junction in the 5' end and initiates translation at an alternate start codon compared to variant 1. The resulting isoform (3, also known as 519) is shorter at the N-terminus compared to isoform 1.