Myosin (MYL6) (NM_079423) Human Untagged Clone

CAT#: SC317249

MYL6 (untagged)-Human myosin, light chain 6, alkali, smooth muscle and non-muscle (MYL6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MYL6
• Synonyms: ESMLC; LC17; LC17-GI; LC17-NM; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_079423, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGTGACTTCACCGAAGACCAGACCGCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTG
  ATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGA
  GGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTT
  CTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTC
  GGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGG
  TGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAAC
  TATGAAGAGCTCGTCCGCATGGTGCTGAATGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_079423
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_079423.3, NP_524147.2
• RefSeq Size: 782 bp
• RefSeq ORF: 456 bp
• Locus ID: 4637
• Cytogenetics: 12q13.2
• Domains: EFh
• Protein Families: Druggable Genome
• Protein Pathways: Vascular smooth muscle contraction
• Gene Summary: 'Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain that is expressed in smooth muscle and non-muscle tissues. Genomic sequences representing several pseudogenes have been described and two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) is the same length as isoform 1, but the proteins differ in their C-terminal sequences.