IGF2 (NM_001007139) Human Untagged Clone

CAT#: SC317276

IGF2 (untagged)-Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IGF2
• Synonyms: C11orf43; GRDF; IGF-II; PP9974; SRS3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001007139, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAATCCCAATGGGGAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATTG
  CTGCTTACCGCCCCAGTGAGACCCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGGA
  CCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGC
  TGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGAGGGACG
  TGTCGACCCCTCCGACCGTGCTTCCGGACAACTTCCCCAGATACCCCGTGGGCAAGTTCTTCCAATATGA
  CACCTGGAAGCAGTCCACCCAGCGCCTGCGCAGGGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCAC
  GTGCTCGCCAAGGAGCTCGAGGCGTTCAGGGAGGCCAAACGTCACCGTCCCCTGATTGCTCTACCCACCC
  AAGACCCCGCCCACGGGGGCGCCCCCCCAGAGATGGCCAGCAATCGGAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001007139
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001007139.5, NP_001007140.2
• RefSeq Size: 5162 bp
• RefSeq ORF: 543 bp
• Locus ID: 3481
• Cytogenetics: 11p15.5
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
• Gene Summary: 'This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]'
  Transcript Variant: This variant (2) contains two alternate 5' non-coding exons, therefore, has a different 5' UTR compared to variant 1. Variants 1, 2, 4 and 5 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.