IGF2 (NM_001007139) Human Untagged Clone
CAT#: SC320234
IGF2 (untagged)-Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2
"NM_001007139" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IGF2 |
Synonyms | C11orf43; GRDF; IGF-II; PP9974; SRS3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001007139.3
CGGCACGAGGCCAGCTCCTAGCCTCCGACTCCCTCCCCCCCTCACGCCCGCCCTCTCGCC
TTCGCCGAACCAAAGTGGATTAATTACACGCTTTCTGTTTCTCTCCGTGCTGTTCTCTCC CGCTGTGCGCCTGCCCGCCTCTCGCTGTCCTCTCTCCCCCTCGCCCTCTCTTCGGCCCCC CCCTTTCACGTTCACTCTGTCTCTCCCACTATCTCTGCCCCCCTCTATCCTTGATACAAC AGCTGACCTCATTTCCCGATACCTTTTCCCCCCCGAAAAGTACAACATCTGGCCCGCCCC AGCCCGAAGACAGCCCGTCCTCCCTGGACAATCAGACGAATTCTCCCCCCCCCCCCCCAA AAAAAAGCCATCCCCCCGCTCTGCCCCGTCGCACATTCGGCCCCCGCGACTCGGCCAGAG CGGCGCTGGCAGAGGAGTGTCCGGCAGGAGGGCCAACGCCCGCTGTTCGGTTTGCGACAC GCAGCAGGGAGGTGGGCGGCAGCGTCGCCGGCTTCCAGACACCAATGGGAATCCCAATGG GGAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATTGCTGCTT ACCGCCCCAGTGAGACCCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCA TCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTA CCCCCGCCAAGTCCGAGAGGGACGTGTCGACCCCTCCGACCGTGCTTCCGGACAACTTCC CCAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGAAGCAGTCCACCCAGCGCC TGCGCAGGGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCACGTGCTCGCCAAGGAGC TCGAGGCGTTCAGGGAGGCCAAACGTCACCGTCCCCTGATTGCTCTACCCACCCAAGACC CCGCCCACGGGGGCGCCCCCCCAGAGATGGCCAGCAATCGGAAGTGAGCAAAACTGCCGC AAGTCTGCAGCCCGGCGCCACCATCCTGCAGCCTCCTCCTGACCACGGACGTTTCCATCA GGTTCCATCCCGAAAATCTCTCGGTTCCACGTCCCCCTGGGGCTTCTCCTGACCCAGTCC CCGTGCCCCGCCTCCCCGAAACAGGCTACTCTCCTCGGCCCCCTCCATCGGGCTGAGGAA GCACAGCAGCATCTTCAAACATGTACAAAATCGATTGGCTTTAAACACCCTTCACATACC CTCCCCCCAAATTATCCCCAATTATCCCCACACATAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001007139 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007139.3, NP_001007140.2 |
RefSeq Size | 5139 bp |
RefSeq ORF | 543 bp |
Locus ID | 3481 |
Cytogenetics | 11p15.5 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Gene Summary | 'This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]' Transcript Variant: This variant (2) contains two alternate 5' non-coding exons, therefore, has a different 5' UTR compared to variant 1. Variants 1, 2, 4 and 5 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC317276 | IGF2 (untagged)-Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2 |
USD 420.00 |
|
RC201849 | IGF2 (Myc-DDK-tagged)-Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2 |
USD 98.00 |
|
RG201849 | IGF2 (GFP-tagged) - Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2 |
USD 460.00 |
|
RC201849L1 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC201849L2 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC201849L3 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC201849L4 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review