TNFAIP8 (NM_014350) Human Untagged Clone
CAT#: SC317294
TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1
"NM_014350" in other vectors (8)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TNFAIP8 |
Synonyms | GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_014350, the custom clone sequence may differ by one or more nucleotides
ATGCACTCCGAAGCAGAAGAATCCAAGGAAGTGGCCACAGATGTCTTTAATTCCAAAAACCTGGCCGTTC AGGCACAAAAGAAGATCTTGGGTAAAATGGTGTCCAAATCCATCGCCACCACCTTAATAGACGACACAAG TAGTGAGGTGCTGGATGAGCTCTACAGAGTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAG ATCATCAAGAACCTCATCAAGACAGTCATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAG ATGAGCTAGCATTGATGGAGAAATTTAAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCA TCAGGTGGATTATACCTTTGACCGGAATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCAC CAAATCATTCAGCGCCACCTCACTGCCAAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAG ATTGTGAATTTTTGGCTGCCTTGTATAATCCTTTTGGGAATTTTAAACCCCACTTACAAAAACTATGTGA TGGTATCAACAAAATGTTGGATGAAGAGAACATATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_014350 |
ORF Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_014350.3, NP_055165.2 |
RefSeq Size | 2103 |
RefSeq ORF | 597 |
Locus ID | 25816 |
Protein Families | Druggable Genome |
Gene Summary | Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes isoform a. Both variant 1 and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC312385 | TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 |
USD 420.00 |
|
SC320774 | TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 |
USD 420.00 |
|
RC202729 | TNFAIP8 (Myc-DDK-tagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 |
USD 98.00 |
|
RG202729 | TNFAIP8 (GFP-tagged) - Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 |
USD 460.00 |
|
RC202729L1 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC202729L2 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC202729L3 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC202729L4 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review