PPCDC (NM_021823) Human Untagged Clone

CAT#: SC317303

PPCDC (untagged)-Human phosphopantothenoylcysteine decarboxylase (PPCDC)


  "NM_021823" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPCDC"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPCDC
Synonyms coaC; MDS018; PPC-DC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021823, the custom clone sequence may differ by one or more nucleotides


ATGGAACCAAAGGCCTCCTGTCCAGCTGCTGCACCCTTGATGGAGAGAAAATTCCATGTTCTTGTGGGTG
TCACGGGGAGTGTCGCAGCCCTGAAGTTGCCTCTTCTGGTGTCAAAGCTTTTGGACATTCCTGGGCTGGA
AGTAGCAGTGGTCACAACTGAGAGAGCCAAACATTTCTACAGCCCCCAGGACATTCCTGTCACCCTCTAC
AGCGACGCTGATGAATGGGAGATATGGAAGAGCCGCTCTGACCCAGTTCTGCACATTGACCTGCGGAGGT
GGGCAGACCTCCTGCTGGTGGCTCCTCTTGATGCCAACACTCTGGGGAAGGTGGCCAGTGGCATCTGTGA
CAACTTGCTTACCTGCGTCATGCGGGCCTGGGACCGCAGCAAGCCCCTGCTCTTCTGCCCGGCCATGAAC
ACCGCCATGTGGGAGCACCCGATCACAGCGCAGCAGGTAGACCAGCTCAAGGCCTTTGGCTATGTCGAGA
TCCCCTGTGTGGCCAAGAAGCTGGTGTGCGGAGATGAAGGTCTCGGGGCCATGGCTGAAGTGGGGACCAT
CGTGGACAAAGTGAAAGAAGTCCTCTTCCAGCACAGTGGCTTCCAGCAGAGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_021823
ORF Size 615 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_021823.4, NP_068595.3
RefSeq Size 2268
RefSeq ORF 615
Locus ID 60490
Domains Flavoprotein
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis
Gene Summary Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.