Kallikrein 14 (KLK14) (NM_022046) Human Untagged Clone
CAT#: SC317386
KLK14 (untagged)-Human kallikrein-related peptidase 14 (KLK14)
"NM_022046" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLK14 |
Synonyms | KLK-L6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_022046, the custom clone sequence may differ by one or more nucleotides
ATGTCCCTGAGGGTCTTGGGCTCTGGGACCTGGCCCTCAGCCCCTAAAATGTTCCTCCTGCTGACAGCAC TTCAAGTCCTGGCTATAGCCATGACACAGAGCCAAGAGGATGAGAACAAGATAATTGGTGGCCATACGTG CACCCGGAGCTCCCAGCCGTGGCAGGCGGCCCTGCTGGCGGGTCCCAGGCGCCGCTTCCTCTGCGGAGGC GCCCTGCTTTCAGGCCAGTGGGTCATCACTGCTGCTCACTGCGGCCGCCCGATCCTTCAGGTTGCCCTGG GCAAGCACAACCTGAGGAGGTGGGAGGCCACCCAGCAGGTGCTGCGCGTGGTTCGTCAGGTGACGCACCC CAACTACAACTCCCGGACCCACGACAACGACCTCATGCTGCTGCAGCTACAGCAGCCCGCACGGATCGGG AGGGCAGTCAGGCCCATTGAGGTCACCCAGGCCTGTGCCAGCCCCGGGACCTCCTGCCGAGTGTCAGGCT GGGGAACTATATCCAGCCCCATCGCCAGGTACCCCGCCTCTCTGCAATGCGTGAACATCAACATCTCCCC GGATGAGGTGTGCCAGAAGGCCTATCCTAGAACCATCACGCCTGGCATGGTCTGTGCAGGAGTTCCCCAG GGCGGGAAGGACTCTTGTCAGGGTGACTCTGGGGGACCCCTGGTGTGCAGAGGACAGCTCCAGGGCCTCG TGTCTTGGGGAATGGAGCGCTGCGCCCTGCCTGGCTACCCCGGTGTCTACACCAACCTGTGCAAGTACAG AAGCTGGATTGAGGAAACGATGCGGGACAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022046 |
ORF Size | 804 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_022046.5, NP_071329.2 |
RefSeq Size | 1022 |
RefSeq ORF | 804 |
Locus ID | 43847 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The altered expression of this gene is implicated in the progression of different cancers including breast and prostate tumors. The encoded protein is a precursor that is proteolytically processed to generate the functional enzyme. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1-3 all encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC123983 | KLK14 (untagged)-Human kallikrein-related peptidase 14 (KLK14) |
USD 310.00 |
|
RC219028 | KLK14 (Myc-DDK-tagged)-Human kallikrein-related peptidase 14 (KLK14) |
USD 420.00 |
|
RG219028 | KLK14 (GFP-tagged) - Human kallikrein-related peptidase 14 (KLK14) |
USD 460.00 |
|
RC219028L1 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), Myc-DDK-tagged |
USD 768.00 |
|
RC219028L2 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), mGFP tagged |
USD 620.00 |
|
RC219028L3 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), Myc-DDK-tagged |
USD 620.00 |
|
RC219028L4 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review