MSX1 (NM_002448) Human Untagged Clone

CAT#: SC317449

MSX1 (untagged)-Human msh homeobox 1 (MSX1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MSX1
• Synonyms: ECTD3; HOX7; HYD1; STHAG1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002448, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCCGGCTGCTGACATGACTTCTTTGCCACTCGGTGTCAAAGTGGAGGACTCCGCCTTCGGCAAGC
  CGGCGGGGGGAGGCGCGGGCCAGGCCCCCAGCGCCGCCGCGGCCACGGCAGCCGCCATGGGCGCGGACGA
  GGAGGGGGCCAAGCCCAAAGTGTCCCCTTCGCTCCTGCCCTTCAGCGTGGAGGCGCTCATGGCCGACCAC
  AGGAAGCCGGGGGCCAAGGAGAGCGCCCTGGCGCCCTCCGAGGGCGTGCAGGCGGCGGGTGGCTCGGCGC
  AGCCACTGGGCGTCCCGCCGGGGTCGCTGGGAGCCCCGGACGCGCCCTCTTCGCCGCGGCCGCTCGGCCA
  TTTCTCGGTGGGGGGACTCCTCAAGCTGCCAGAAGATGCGCTCGTCAAAGCCGAGAGCCCCGAGAAGCCC
  GAGAGGACCCCGTGGATGCAGAGCCCCCGCTTCTCCCCGCCGCCGGCCAGGCGGCTGAGCCCCCCAGCCT
  GCACCCTCCGCAAACACAAGACGAACCGTAAGCCGCGGACGCCCTTCACCACCGCGCAGCTGCTGGCGCT
  GGAGCGCAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGCGCGGAGTTCTCCAGCTCGCTCAGC
  CTCACTGAGACGCAGGTGAAGATATGGTTCCAGAACCGCCGCGCCAAGGCAAAGAGACTACAAGAGGCAG
  AGCTGGAGAAGCTGAAGATGGCCGCCAAGCCCATGCTGCCACCGGCTGCCTTCGGCCTCTCCTTCCCTCT
  CGGCGGCCCCGCAGCTGTAGCGGCCGCGGCGGGTGCCTCGCTCTACGGTGCCTCTGGCCCCTTCCAGCGC
  GCCGCGCTGCCTGTGGCGCCCGTGGGACTCTACACGGCCCATGTGGGCTACAGCATGTACCACCTGACAT
  AG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002448
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002448.3, NP_002439.2
• RefSeq Size: 1940 bp
• RefSeq ORF: 912 bp
• Locus ID: 4487
• Cytogenetics: 4p16.2
• Domains: homeobox
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a member of the muscle segment homeobox gene family. The encoded protein functions as a transcriptional repressor during embryogenesis through interactions with components of the core transcription complex and other homeoproteins. It may also have roles in limb-pattern formation, craniofacial development, particularly odontogenesis, and tumor growth inhibition. Mutations in this gene, which was once known as homeobox 7, have been associated with nonsyndromic cleft lip with or without cleft palate 5, Witkop syndrome, Wolf-Hirschom syndrome, and autosomoal dominant hypodontia. [provided by RefSeq, Jul 2008]'