BPNT1 (NM_006085) Human Untagged Clone

CAT#: SC317461

BPNT1 (untagged)-Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1)


  "NM_006085" in other vectors (7)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BPNT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BPNT1
Synonyms HEL20; PIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_006085, the custom clone sequence may differ by one or more nucleotides


ATGGCTTCCAGTAACACTGTGTTGATGCGGTTGGTAGCCTCCGCATATTCTATTGCTCAAAAGGCAGGAA
TGATAGTCAGACGTGTTATTGCTGAAGGAGACCTGGGTATTGTGGAGAAGACCTGTGCAACAGACCTGCA
GACCAAAGCTGACCGATTGGCACAGATGAGCATATGTTCTTCATTGGCCCGGAAATTCCCCAAACTCACA
ATTATAGGGGAAGAGGATCTGCCTTCTGAGGAAGTGGATCAAGAGCTGATTGAAGACAGTCAGTGGGAAG
AAATACTGAAGCAACCATGCCCATCGCAGTACAGTGCTATTAAAGAAGAAGATCTCGTGGTCTGGGTTGA
TCCTCTGGATGGAACCAAGGAATATACCGAAGGTCTTCTTGACAATGTAACAGTTCTTATTGGAATTGCT
TATGAAGGAAAAGCCATAGCAGGAGTTATTAACCAGCCATATTACAACTATGAGGCAGGACCAGATGCTG
TGTTGGGGAGGACAATCTGGGGAGTTTTAGGTTTAGGCGCCTTTGGGTTTCAGCTGAAAGAAGTCCCTGC
TGGGAAACACATTATCACAACTACTCGATCCCATAGCAACAAGTTGGTTACTGACTGTGTTGCTGCTATG
AACCCCGATGCTGTGCTGCGAGTAGGAGGAGCAGGAAATAAGATTATTCAGCTGATTGAAGGCAAAGCCT
CTGCTTATGTATTTGCAAGTCCTGGTTGTAAGAAGTGGGATACTTGTGCTCCAGAAGTTATTTTACATGC
TGTGGGAGGCAAGTTAACCGATATCCATGGGAATGTTCTTCAGTACCACAAGGATGTGAAGCATATGAAC
TCTGCAGGAGTCCTGGCCACACTGAGGAATTATGACTACTATGCAAGCCGAGTTCCAGAATCTATTAAAA
ATGCACTTGTTCCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_006085
ORF Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_006085.5, NP_006076.4
RefSeq Size 2465
RefSeq ORF 927
Locus ID 10380
Domains inositol_P
Protein Pathways Sulfur metabolism
Gene Summary BPNT1, also called bisphosphate 3-prime-nucleotidase, or BPntase, is a member of a magnesium-dependent phosphomonoesterase family. Lithium, a major drug used to treat manic depression, acts as an uncompetitive inhibitor of BPntase. The predicted human protein is 92% identical to mouse BPntase. BPntase's physiologic role in nucleotide metabolism may be regulated by inositol signaling pathways. The inhibition of human BPntase may account for lithium-induced nephrotoxicity. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.