UCP4 (SLC25A27) (NM_004277) Human Untagged Clone

CAT#: SC317491

SLC25A27 (untagged)-Human solute carrier family 25, member 27 (SLC25A27), nuclear gene encoding mitochondrial protein, transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC25A27
• Synonyms: UCP4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_004277, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCGTCCCGGAGGAGGAGGAGAGGCTTTTGCCGCTGACCCAGAGATGGCCCCGAGCGAGCAAATTCC
  TACTGTCCGGCTGCGCGGCTACCGTGGCCGAGCTAGCAACCTTTCCCCTGGATCTCACAAAAACTCGACT
  CCAAATGCAAGGAGAAGCAGCTCTTGCTCGGTTGGGAGACGGTGCAAGAGAATCTGCCCCCTATAGGGGA
  ATGGTGCGCACAGCTCTAGGGATCATTGAAGAGGAAGGCTTTCTAAAGCTTTGGCAAGGAGTGACACCCG
  CCATTTACAGACACGTAGTGTATTCTGGAGGTCGAATGGTCACATATGAACATCTCCGAGAGGTTGTGTT
  TGGCAAAAGTGAAGATGAGCATTATCCCCTTTGGAAATCAGTCATTGGAGGGATGATGGCTGGTGTTATT
  GGCCAGTTTTTAGCCAATCCAACTGACCTAGTGAAGGTTCAGATGCAAATGGAAGGAAAAAGGAAACTGG
  AAGGAAAACCATTGCGATTTCGTGGTGTACATCATGCATTTGCAAAAATCTTAGCTGAAGGAGGAATACG
  AGGGCTTTGGGCAGGCTGGGTACCCAATATACAAAGAGCAGCACTGGTGAATATGGGAGATTTAACCACT
  TATGATACAGTGAAACACTACTTGGTATTGAATACACCACTTGAGGACAATATCATGACTCACGGTTTAT
  CAAGTTTATGTTCTGGACTGGTAGCTTCTATTCTGGGAACACCAGCCGATGTCATCAAAAGCAGAATAAT
  GAATCAACCACGAGATAAACAAGGAAGGGGACTTTTGTATAAATCATCGACTGACTGCTTGATTCAGGCT
  GTTCAAGGTGAAGGATTCATGAGTCTATATAAAGGCTTTTTACCATCTTGGCTGAGAATGACCCCTTGGT
  CAATGGTGTTCTGGCTTACTTATGAAAAAATCAGAGAGATGAGTGGAGTCAGTCCATTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_004277
• ORF Size: 972 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_004277.4, NP_004268.3
• RefSeq Size: 2986
• RefSeq ORF: 972
• Locus ID: 9481
• Domains: mito_carr
• Protein Families: Druggable Genome
• Gene Summary: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. Transcripts of this gene are only detected in brain tissue and are specifically modulated by various environmental conditions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.