HuC (ELAVL3) (NM_032281) Human Untagged Clone

CAT#: SC317571

ELAVL3 (untagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (ELAVL3), transcript variant 2


  "NM_032281" in other vectors (5)

Reconstitution Protocol

USD 610.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ELAVL3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ELAVL3
Synonyms HUC; HUCL; PLE21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_032281, the custom clone sequence may differ by one or more nucleotides


ATGGTCACTCAGATACTGGGGGCCATGGAGTCTCAGGTGGGGGGGGGCCCGGCCGGCCCGGCCCTGCCCA
ACGGGCCACTCCTTGGTACAAATGGAGCCACTGACGACAGCAAGACCAACCTCATCGTCAACTACCTGCC
CCAGAACATGACCCAGGATGAGTTCAAGAGTCTCTTCGGCAGCATTGGCGACATCGAGTCCTGCAAGTTG
GTTCGGGACAAGATCACAGGGCAGAGCCTTGGCTACGGGTTTGTGAACTATTCTGACCCCAATGATGCAG
ACAAAGCCATCAACACCCTCAACGGCCTCAAATTACAGACGAAGACCATCAAGGTGTCCTATGCCAGACC
CAGTTCAGCATCCATCCGGGATGCTAACCTGTACGTCAGCGGGCTCCCCAAGACCATGAGCCAGAAAGAG
ATGGAGCAGCTCTTCTCCCAGTACGGCCGCATCATCACGTCCCGCATCCTGGTGGACCAGGTCACAGGTG
TCTCTCGGGGTGTGGGATTCATCCGCTTTGACAAGAGGATTGAGGCCGAAGAGGCTATCAAAGGACTGAA
TGGGCAGAAGCCGCTGGGCGCAGCTGAGCCCATCACAGTCAAGTTCGCGAACAACCCAAGTCAGAAGACG
GGGCAGGCGCTGCTCACCCACCTCTACCAGTCATCCGCCCGGCGCTACGCAGGCCCCCTACACCATCAGA
CCCAGCGTTTCCGGCTGGACAATTTGCTCAACATGGCCTACGGCGTCAAGAGGTTCTCGCCGATCGCCAT
CGATGGTATGAGCGGCCTGGCGGGCGTGGGCCTGTCGGGGGGCGCGGCGGGCGCCGGCTGGTGCATCTTC
GTGTACAACCTGTCACCGGAGGCAGACGAGAGCGTGCTGTGGCAGCTGTTCGGGCCTTTTGGGGCAGTCA
CCAACGTCAAGGTCATCCGTGATTTCACCACCAACAAGTGCAAGGGTTTCGGCTTCGTGACCATGACCAA
CTATGACGAGGCGGCCATGGCCATCGCCAGCCTGAACGGCTATCGCCTGGGCGAGCGCGTGCTGCAGGTC
TCCTTCAAGACCAGCAAACAGCACAAGGCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_032281
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032281.2, NP_115657.2
RefSeq Size 4661 bp
RefSeq ORF 1083 bp
Locus ID 1995
Cytogenetics 19p13.2
Gene Summary 'A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) lacks an in-frame segment in the coding region, as compared to variant 1. It encodes isoform 2 which lacks an internal segment, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.