TCF7 (NM_003202) Human Untagged Clone

CAT#: SC317616

TCF7 (untagged)-Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TCF7
• Synonyms: TCF-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_003202, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGCAGCTGGACTCCGGCGGGGGCGGCGCGGGCGGCGGCGACGACCTCGGCGCGCCGGACGAGCTGC
  TGGCCTTCCAGGATGAAGGCGAGGAGCAGGACGACAAGAGCCGCGACAGCGCCGCCGGTCCCGAGCGCGA
  CCTGGCCGAGCTCAAGTCGTCGCTCGTGAACGAGTCCGAGGGCGCGGCCGGCGGCGCAGGGATCCCGGGG
  GTCCCGGGGGCCGGCGCCGGGGCCCGCGGCGAGGCCGAGGCTCTCGGGCGGGAACACGCTGCGCAGAGAC
  TCTTCCCGGACAAACTTCCAGAGCCCCTGGAGGACGGCCTGAAGGCCCCGGAGTGCACCAGCGGCATGTA
  CAAAGAGACCGTCTACTCCGCCTTCAATCTGCTCATGCATTACCCACCCCCCTCGGGAGCAGGGCAGCAC
  CCCCAGCCGCAGCCCCCGCTGCACAAGGCCAATCAGCCCCCCCACGGTGTCCCCCAACTCTCTCTCTACG
  AACATTTCAACAGCCCACATCCCACCCCTGCACCTGCGGACATCAGCCAGAAGCAAGTTCACAGGCCTCT
  GCAGACCCCTGACCTCTCTGGCTTCTACTCCCTGACCTCAGGCAGCATGGGGCAGCTCCCCCACACTGTG
  AGCTGGTTCACCCACCCATCCTTGATGCTAGGTTCTGGTGTACCTGGTCACCCAGCAGCCATCCCCCACC
  CGGCCATTGTGCCCCCCTCAGGGAAGCAGGAGCTGCAGCCCTTCGACCGCAACCTGAAGACACAAGCAGA
  GTCCAAGGCAGAGAAGGAGGCCAAGAAGCCAACCATCAAGAAGCCCCTCAATGCCTTCATGCTGTACATG
  AAGGAGATGAGAGCCAAGGTCATTGCAGAGTGCACACTTAAGGAGAGCGCTGCCATCAACCAGATCCTGG
  GCCGCAGGTGGCACGCGCTGTCGCGAGAAGAGCAGGCCAAGTACTATGAGCTGGCCCGCAAGGAGAGGCA
  GCTGCACATGCAGCTATACCCAGGCTGGTCAGCGCGGGACAACTACGGGAAGAAGAAGAGGCGGTCGAGG
  GAAAAGCACCAAGAATCCACCACAGGAGGAAAAAGAAATGCATTCGGTACTTACCCGGAGAAGGCCGCTG
  CCCCAGCCCCGTTCCTTCCGATGACAGTGCTCTAG
  
  
• Restriction Sites: Please inquire
• ACCN: NM_003202
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_003202.2, NP_003193.2
• RefSeq Size: 3283 bp
• RefSeq ORF: 1155 bp
• Locus ID: 6932
• Cytogenetics: 5q31.1
• Domains: HMG
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
• Protein Pathways: Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway
• Gene Summary: 'This gene encodes a member of the T-cell factor/lymphoid enhancer-binding factor family of high mobility group (HMG) box transcriptional activators. This gene is expressed predominantly in T-cells and plays a critical role in natural killer cell and innate lymphoid cell development. The encoded protein forms a complex with beta-catenin and activates transcription through a Wnt/beta-catenin signaling pathway. Mice with a knockout of this gene are viable and fertile, but display a block in T-lymphocyte differentiation. Alternative splicing results in multiple transcript variants. Naturally-occurring isoforms lacking the N-terminal beta-catenin interaction domain may act as dominant negative regulators of Wnt signaling. [provided by RefSeq, Oct 2016]'
  Transcript Variant: This variant (1) encodes isoform (1).