Doublecortin (DCX) (NM_000555) Human Untagged Clone
CAT#: SC317722
DCX (untagged)-Human doublecortin (DCX), transcript variant 1
"NM_000555" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DCX |
Synonyms | DBCN; DC; LISX; SCLH; XLIS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_000555, the custom clone sequence may differ by one or more nucleotides
ATGAAAACACTCCCCCTTCATAGTCATTGTACTGAAATGCAAAGACTGCTTCCTAAGCTGGAGATGCTAA CCTTGGGTAGCTCCTTCTGTTCTCTTCAAGGGGAATTTTGTCAGGCTATGGATTCATTTACAACTGTTAG TCATGTGGGCATGTGTGAGGAAACAGATGCCAGTTTTAATGTATTTAGCCCGAAGTTCCAATTTGATAGG AGCCACTGTCAGTCTCTGAGGTTCCACCAAAATATGGAACTTGATTTTGGACACTTTGACGAAAGAGATA AGACATCCAGGAACATGCGAGGCTCCCGGATGAATGGGTTGCCTAGCCCCACTCACAGCGCCCACTGTAG CTTCTACCGAACCAGAACCTTGCAGGCACTGAGTAATGAGAAGAAAGCCAAGAAGGTACGTTTCTACCGC AATGGGGACCGCTACTTCAAGGGGATTGTGTACGCTGTGTCCTCTGACCGTTTTCGCAGCTTTGACGCCT TGCTGGCTGACCTGACGCGATCTCTGTCTGACAACATCAACCTGCCTCAGGGAGTGCGTTACATTTACAC CATTGATGGATCCAGGAAGATCGGAAGCATGGATGAACTGGAGGAAGGGGAAAGCTATGTCTGTTCCTCA GACAACTTCTTTAAAAAGGTGGAGTACACCAAGAATGTCAATCCCAACTGGTCTGTCAACGTAAAAACAT CTGCCAATATGAAAGCCCCCCAGTCCTTGGCTAGCAGCAACAGTGCACAGGCCAGGGAGAACAAGGACTT TGTGCGCCCCAAGCTGGTTACCATCATCCGCAGTGGGGTGAAGCCTCGGAAGGCTGTGCGTGTGCTTCTG AACAAGAAGACAGCCCACTCTTTTGAGCAAGTCCTCACTGATATCACAGAAGCCATCAAACTGGAGACCG GGGTTGTCAAAAAACTCTACACTCTGGATGGAAAACAGGTAACTTGTCTCCATGATTTCTTTGGTGATGA TGATGTGTTTATTGCCTGTGGTCCTGAAAAATTTCGCTATGCTCAGGATGATTTTTCTCTGGATGAAAAT GAATGCCGAGTCATGAAGGGAAACCCATCAGCCACAGCTGGCCCAAAGGCATCCCCAACACCTCAGAAGA CTTCAGCCAAGAGCCCTGGTCCTATGCGCCGAAGCAAGTCTCCAGCTGACTCAGCAAACGGAACCTCCAG CAGCCAGCTCTCTACCCCCAAGTCTAAGCAGTCTCCCATCTCTACGCCCACCAGTCCTGGCAGCCTCCGG AAGCACAAGGACCTGTACCTGCCTCTGTCCTTGGATGACTCGGACTCGCTTGGTGATTCCATGTAA |
Restriction Sites | Please inquire |
ACCN | NM_000555 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000555.2, NP_000546.2 |
RefSeq Size | 9433 bp |
RefSeq ORF | 1326 bp |
Locus ID | 1641 |
Cytogenetics | Xq23 |
Domains | DCX |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase, and this interaction is important to proper microtubule function in the developing cortex. Mutations in this gene cause abnormal migration of neurons during development and disrupt the layering of the cortex, leading to epilepsy, cognitive disability, subcortical band heterotopia ("double cortex" syndrome) in females and lissencephaly ("smooth brain" syndrome) in males. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]' Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC111620 | DCX (untagged)-Human doublecortin (DCX), transcript variant 1 |
USD 740.00 |
|
RC215014 | DCX (Myc-DDK-tagged)-Human doublecortin (DCX), transcript variant 1 |
USD 460.00 |
|
RG215014 | DCX (GFP-tagged) - Human doublecortin (DCX), transcript variant 1 |
USD 510.00 |
|
RC215014L3 | Lenti-ORF clone of DCX (Myc-DDK-tagged)-Human doublecortin (DCX), transcript variant 1 |
USD 660.00 |
|
RC215014L4 | Lenti-ORF clone of DCX (mGFP-tagged)-Human doublecortin (DCX), transcript variant 1 |
USD 660.00 |
{0} Product Review(s)
Be the first one to submit a review