Glutathione Reductase (GSR) (NM_000637) Human Untagged Clone
CAT#: SC317883
GSR (untagged)-Human glutathione reductase (GSR), transcript variant 1
"NM_000637" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GSR |
Synonyms | GR; GSRD; HEL-75; HEL-S-122m |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_000637, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTGCTGCCCCGAGCCCTGAGCGCCGGCGCGGGACCGAGCTGGCGGCGGGCGGCGCGCGCCTTCC GAGGCTTCCTGCTGCTTCTGCCCGAGCCCGCGGCCCTCACGCGCGCCCTCTCCCGTGCCATGGCCTGCAG GCAGGAGCCGCAGCCGCAGGGCCCGCCGCCCGCTGCTGGCGCCGTGGCCTCCTATGACTACCTGGTGATC GGGGGCGGCTCGGGCGGGCTGGCCAGCGCGCGCAGGGCGGCCGAGCTGGGTGCCAGGGCCGCCGTGGTGG AGAGCCACAAGCTGGGTGGCACTTGCGTGAATGTTGGATGTGTACCCAAAAAGGTAATGTGGAACACAGC TGTCCACTCTGAATTCATGCATGATCATGCTGATTATGGCTTTCCAAGTTGTGAGGGTAAATTCAATTGG CGTGTTATTAAGGAAAAGCGGGATGCCTATGTGAGCCGCCTGAATGCCATCTATCAAAACAATCTCACCA AGTCCCATATAGAAATCATCCGTGGCCATGCAGCCTTCACGAGTGATCCCAAGCCCACAATAGAGGTCAG TGGGAAAAAGTACACCGCCCCACACATCCTGATCGCCACAGGTGGTATGCCCTCCACCCCTCATGAGAGC CAGATCCCCGGTGCCAGCTTAGGAATAACCAGCGATGGATTTTTTCAGCTGGAAGAATTGCCCGGCCGCA GCGTCATTGTTGGTGCAGGTTACATTGCTGTGGAGATGGCAGGGATCCTGTCAGCCCTGGGTTCTAAGAC ATCACTGATGATACGGCATGATAAGGTACTTAGAAGTTTTGATTCAATGATCAGCACCAACTGCACGGAG GAGCTGGAGAACGCTGGCGTGGAGGTGCTGAAGTTCTCCCAGGTCAAGGAGGTTAAAAAGACTTTGTCGG GCTTGGAAGTCAGCATGGTTACTGCAGTTCCCGGTAGGCTACCAGTCATGACCATGATTCCAGATGTTGA CTGCCTGCTCTGGGCCATTGGGCGGGTCCCGAATACCAAGGACCTGAGTTTAAACAAACTGGGGATTCAA ACCGATGACAAGGGTCATATCATCGTAGACGAATTCCAGAATACCAACGTCAAAGGCATCTATGCAGTTG GGGATGTATGTGGAAAAGCTCTTCTTACTCCAGTTGCAATAGCTGCTGGCCGAAAACTTGCCCATCGACT TTTTGAATATAAGGAAGATTCCAAATTAGATTATAACAACATCCCAACTGTGGTCTTCAGCCACCCCCCT ATTGGGACAGTGGGACTCACGGAAGATGAAGCCATTCATAAATATGGAATAGAAAATGTGAAGACCTATT CAACGAGCTTTACCCCGATGTATCACGCAGTTACCAAAAGGAAAACAAAATGTGTGATGAAAATGGTCTG TGCTAACAAGGAAGAAAAGGTGGTTGGGATCCATATGCAGGGACTTGGGTGTGATGAAATGCTGCAGGGT TTTGCTGTTGCAGTGAAGATGGGAGCAACGAAGGCAGACTTTGACAACACAGTCGCCATTCACCCTACCT CTTCAGAAGAGCTGGTCACACTTCGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_000637 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000637.3, NP_000628.2 |
RefSeq Size | 3174 bp |
RefSeq ORF | 1569 bp |
Locus ID | 2936 |
Cytogenetics | 8p12 |
Domains | pyr_redox, pyr_redox_dim |
Protein Families | Druggable Genome |
Protein Pathways | Glutathione metabolism |
Gene Summary | 'This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]' Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC108586 | GSR (untagged)-Human glutathione reductase (GSR), transcript variant 1 |
USD 310.00 |
|
SC320532 | GSR (untagged)-Human glutathione reductase (GSR), transcript variant 1 |
USD 310.00 |
|
RC209652 | GSR (Myc-DDK-tagged)-Human glutathione reductase (GSR), transcript variant 1 |
USD 420.00 |
|
RG209652 | GSR (GFP-tagged) - Human glutathione reductase (GSR), transcript variant 1 |
USD 460.00 |
|
RC209652L3 | Lenti ORF clone of Human glutathione reductase (GSR), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC209652L4 | Lenti ORF clone of Human glutathione reductase (GSR), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review