Glutathione Reductase (GSR) (NM_000637) Human Untagged Clone

CAT#: SC317883

GSR (untagged)-Human glutathione reductase (GSR), transcript variant 1


  "NM_000637" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSR
Synonyms GR; GSRD; HEL-75; HEL-S-122m
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_000637, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTGCTGCCCCGAGCCCTGAGCGCCGGCGCGGGACCGAGCTGGCGGCGGGCGGCGCGCGCCTTCC
GAGGCTTCCTGCTGCTTCTGCCCGAGCCCGCGGCCCTCACGCGCGCCCTCTCCCGTGCCATGGCCTGCAG
GCAGGAGCCGCAGCCGCAGGGCCCGCCGCCCGCTGCTGGCGCCGTGGCCTCCTATGACTACCTGGTGATC
GGGGGCGGCTCGGGCGGGCTGGCCAGCGCGCGCAGGGCGGCCGAGCTGGGTGCCAGGGCCGCCGTGGTGG
AGAGCCACAAGCTGGGTGGCACTTGCGTGAATGTTGGATGTGTACCCAAAAAGGTAATGTGGAACACAGC
TGTCCACTCTGAATTCATGCATGATCATGCTGATTATGGCTTTCCAAGTTGTGAGGGTAAATTCAATTGG
CGTGTTATTAAGGAAAAGCGGGATGCCTATGTGAGCCGCCTGAATGCCATCTATCAAAACAATCTCACCA
AGTCCCATATAGAAATCATCCGTGGCCATGCAGCCTTCACGAGTGATCCCAAGCCCACAATAGAGGTCAG
TGGGAAAAAGTACACCGCCCCACACATCCTGATCGCCACAGGTGGTATGCCCTCCACCCCTCATGAGAGC
CAGATCCCCGGTGCCAGCTTAGGAATAACCAGCGATGGATTTTTTCAGCTGGAAGAATTGCCCGGCCGCA
GCGTCATTGTTGGTGCAGGTTACATTGCTGTGGAGATGGCAGGGATCCTGTCAGCCCTGGGTTCTAAGAC
ATCACTGATGATACGGCATGATAAGGTACTTAGAAGTTTTGATTCAATGATCAGCACCAACTGCACGGAG
GAGCTGGAGAACGCTGGCGTGGAGGTGCTGAAGTTCTCCCAGGTCAAGGAGGTTAAAAAGACTTTGTCGG
GCTTGGAAGTCAGCATGGTTACTGCAGTTCCCGGTAGGCTACCAGTCATGACCATGATTCCAGATGTTGA
CTGCCTGCTCTGGGCCATTGGGCGGGTCCCGAATACCAAGGACCTGAGTTTAAACAAACTGGGGATTCAA
ACCGATGACAAGGGTCATATCATCGTAGACGAATTCCAGAATACCAACGTCAAAGGCATCTATGCAGTTG
GGGATGTATGTGGAAAAGCTCTTCTTACTCCAGTTGCAATAGCTGCTGGCCGAAAACTTGCCCATCGACT
TTTTGAATATAAGGAAGATTCCAAATTAGATTATAACAACATCCCAACTGTGGTCTTCAGCCACCCCCCT
ATTGGGACAGTGGGACTCACGGAAGATGAAGCCATTCATAAATATGGAATAGAAAATGTGAAGACCTATT
CAACGAGCTTTACCCCGATGTATCACGCAGTTACCAAAAGGAAAACAAAATGTGTGATGAAAATGGTCTG
TGCTAACAAGGAAGAAAAGGTGGTTGGGATCCATATGCAGGGACTTGGGTGTGATGAAATGCTGCAGGGT
TTTGCTGTTGCAGTGAAGATGGGAGCAACGAAGGCAGACTTTGACAACACAGTCGCCATTCACCCTACCT
CTTCAGAAGAGCTGGTCACACTTCGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_000637
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000637.3, NP_000628.2
RefSeq Size 3174 bp
RefSeq ORF 1569 bp
Locus ID 2936
Cytogenetics 8p12
Domains pyr_redox, pyr_redox_dim
Protein Families Druggable Genome
Protein Pathways Glutathione metabolism
Gene Summary 'This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]'
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.