HCK (NM_002110) Human Untagged Clone
CAT#: SC317892
HCK (untagged)-Human hemopoietic cell kinase (HCK), transcript variant 1
"NM_002110" in other vectors (8)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HCK |
Synonyms | JTK9; p59Hck; p61Hck |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002110 edited
ATGGGGGGGCGCTCAAGCTGCGAGGATCCGGGCTGCCCGCGAGACGAGGAGCGGGCGCCC AGGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGGGAGGCAGGCTCTGAGGAC ATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTCCAG AAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCCCTG GCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTGGAG ACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCT CCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTAC TCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAGATC CGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTGCAG GAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTGCCC TGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGGGAA TCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACC TACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTGGAG GCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTT CATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGC TTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATTGAC TTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCACCGA GACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGACTTT GGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTCCCC ATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGACGTC TGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCAGGG ATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAG AACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAGGAG CGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAGAGC CAGTACCAACAGCAGCCATGA |
Restriction Sites | Please inquire |
ACCN | NM_002110 |
Insert Size | 1600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002110.2, NP_002101.2 |
RefSeq Size | 2105 bp |
RefSeq ORF | 1581 bp |
Locus ID | 3055 |
Cytogenetics | 20q11.21 |
Domains | pkinase, SH2, TyrKc, SH3, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Chemokine signaling pathway, Fc gamma R-mediated phagocytosis |
Gene Summary | 'The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010]' Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons, as demonstrated in PMIDs 1875927 and 7791757. The longer isoform (a, also known as p61HCK) is derived from an upstream non-AUG (CUG) start codon, while the shorter isoform (b, also known as p59HCK) is derived from a downstream AUG start codon. The longer isoform (a) is represented in this RefSeq. CCDS Note: This CCDS, which is supported by the mRNAs AK026432.1, BC108930.1 and others, represents a long human HCK isoform, known as p61HCK, as described in PMIDs 1875927 and 7791757. This isoform initiates translation from a non-AUG (CUG) start codon that is well-conserved and present in a strong Kozak signal context. Alternative translation initiation from a downstream AUG start codon produces an isoform that is 21 aa shorter at the N-terminus. The shorter isoform, which is known as p59HCK, is represented by CCDS 54455.1. These isoforms exhibit distinct subcellular distributions, as indicated in PMID:7791757. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC118838 | HCK (untagged)-Human hemopoietic cell kinase (HCK), transcript variant 1 |
USD 760.00 |
|
SC323684 | HCK (untagged)-Kinase deficient mutant (K269M) of Human hemopoietic cell kinase (HCK) |
USD 760.00 |
|
RC217022 | HCK (Myc-DDK-tagged)-Human hemopoietic cell kinase (HCK), transcript variant 1 |
USD 420.00 |
|
RG217022 | HCK (GFP-tagged) - Human hemopoietic cell kinase (HCK), transcript variant 1 |
USD 460.00 |
|
RC217022L1 | Lenti ORF clone of Human hemopoietic cell kinase (HCK), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC217022L2 | Lenti ORF clone of Human hemopoietic cell kinase (HCK), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC217022L3 | Lenti ORF clone of Human hemopoietic cell kinase (HCK), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC217022L4 | Lenti ORF clone of Human hemopoietic cell kinase (HCK), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review