UGT2B15 (NM_001076) Human Untagged Clone
CAT#: SC317900
UGT2B15 (untagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15)
"NM_001076" in other vectors (8)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UGT2B15 |
Synonyms | HLUG4; UDPGT 2B8; UDPGT2B15; UDPGTH3; UGT2B8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001076, the custom clone sequence may differ by one or more nucleotides
ATGTCTCTGAAATGGACGTCAGTCTTTCTGCTGATACAGCTCAGTTGTTACTTTAGCTCTGGAAGCTGTG GAAAGGTGCTAGTGTGGCCCACAGAATACAGCCATTGGATAAATATGAAGACAATCCTGGAAGAGCTTGT TCAGAGGGGTCATGAGGTGACTGTGTTGACATCTTCGGCTTCTACTCTTGTCAATGCCAGTAAATCATCT GCTATTAAATTAGAAGTTTATCCTACATCTTTAACTAAAAATTATTTGGAAGATTCTCTTCTGAAAATTC TCGATAGATGGATATATGGTGTTTCAAAAAATACATTTTGGTCATATTTTTCACAATTACAAGAATTGTG TTGGGAATATTATGACTACAGTAACAAGCTCTGTAAAGATGCAGTTTTGAATAAGAAACTTATGATGAAA CTACAAGAGTCAAAGTTTGATGTCATTCTGGCAGATGCCCTTAATCCCTGTGGTGAGCTACTGGCTGAAC TATTTAACATACCCTTTCTGTACAGTCTTCGATTCTCTGTTGGCTACACATTTGAGAAGAATGGTGGAGG ATTTCTGTTCCCTCCTTCCTATGTACCTGTTGTTATGTCAGAATTAAGTGATCAAATGATTTTCATGGAG AGGATAAAAAATATGATACATATGCTTTATTTTGACTTTTGGTTTCAAATTTATGATCTGAAGAAGTGGG ACCAGTTTTATAGTGAAGTTCTAGGAAGACCCACTACATTATTTGAGACAATGGGGAAAGCTGAAATGTG GCTCATTCGAACCTATTGGGATTTTGAATTTCCTCGCCCATTCTTACCAAATGTTGATTTTGTTGGAGGA CTTCACTGTAAACCAGCCAAACCCCTGCCTAAGGAAATGGAAGAGTTTGTGCAGAGCTCTGGAGAAAATG GTATTGTGGTGTTTTCTCTGGGGTCGATGATCAGTAACATGTCAGAAGAAAGTGCCAACATGATTGCATC AGCCCTTGCCCAGATCCCACAAAAGGTTCTATGGAGATTTGATGGCAAGAAGCCAAATACTTTAGGTTCC AATACTCGACTGTACAAGTGGTTACCCCAGAATGACCTTCTTGGTCATCCCAAAACCAAAGCTTTTATAA CTCATGGTGGAACCAATGGCATCTATGAGGCGATCTACCATGGGATCCCTATGGTGGGCATTCCCTTGTT TGCGGATCAACATGATAACATTGCTCACATGAAAGCCAAGGGAGCAGCCCTCAGTGTGGACATCAGGACC ATGTCAAGTAGAGATTTGCTCAATGCATTGAAGTCAGTCATTAATGACCCTGTCTATAAAGAGAATGTCA TGAAATTATCAAGAATTCATCATGACCAACCAATGAAGCCCCTGGATCGAGCAGTCTTCTGGATTGAGTT TGTCATGCGCCACAAAGGAGCCAAGCACCTTCGAGTCGCAGCTCACAACCTCACCTGGATCCAGTACCAC TCTTTGGATGTGATAGCATTCCTGCTGGCCTGCGTGGCAACTGTGATATTTATCATCACAAAATTTTGCC TGTTTTGTTTCCGAAAGCTTGCCAAAAAAGGAAAGAAGAAGAAAAGAGATTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001076 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001076.3, NP_001067.2 |
RefSeq Size | 2264 bp |
RefSeq ORF | 1593 bp |
Locus ID | 7366 |
Cytogenetics | 4q13.2 |
Domains | UDPGT |
Protein Families | Transmembrane |
Protein Pathways | Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism |
Gene Summary | 'This gene encodes a glycosyltransferase that is invovled in the metabolism and elimination of toxic compounts, both endogenous and of xenobiotic origin. This gene plays a role in the regulation of estrogens and androgens. This locus is present in a cluster of similar genes and pseudogenes on chromosome 4. [provided by RefSeq, Aug 2016]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC123996 | UGT2B15 (untagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 900.00 |
|
SC317899 | UGT2B15 (untagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 900.00 |
|
RC215344 | UGT2B15 (Myc-DDK-tagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 480.00 |
|
RG215344 | UGT2B15 (GFP-tagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 530.00 |
|
RC215344L1 | Lenti-ORF clone of UGT2B15 (Myc-DDK-tagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 840.00 |
|
RC215344L2 | Lenti-ORF clone of UGT2B15 (mGFP-tagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 840.00 |
|
RC215344L3 | Lenti-ORF clone of UGT2B15 (Myc-DDK-tagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 680.00 |
|
RC215344L4 | Lenti-ORF clone of UGT2B15 (mGFP-tagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B15 (UGT2B15) |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review