BCKDH kinase (BCKDK) (NM_001122957) Human Untagged Clone
CAT#: SC318839
BCKDK (untagged)-Human branched chain ketoacid dehydrogenase kinase (BCKDK), nuclear gene encoding mitochondrial protein, transcript variant 2
"NM_001122957" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | BCKDK |
| Synonyms | BCKDKD; BDK |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001122957, the custom clone sequence may differ by one or more nucleotides
ATGATCCTGGCGTCGGTGCTGAGGAGCGGTCCCGGGGGCGGGCTTCCGCTCCGGCCCCTCCTGGGACCCG CACTCGCGCTCCGGGCCCGCTCGACGTCGGCCACCGACACACACCACGTGGAGATGGCTCGGGAGCGCTC CAAGACCGTCACCTCCTTTTACAACCAGTCGGCCATCGACGCGGCAGCGGAGAAGCCCTCAGTCCGCCTA ACGCCCACCATGATGCTCTACGCTGGCCGCTCTCAGGACGGCAGCCACCTTCTGAAAAGTGCTCGGTACC TGCAGCAAGAACTTCCAGTGAGGATTGCTCACCGCATCAAGGGCTTCCGCTGCCTTCCTTTCATCATTGG CTGCAACCCCACCATACTGCACGTGCATGAGCTATATATCCGTGCCTTCCAGAAGCTGACAGACTTCCCT CCGATCAAGGACCAGGCGGACGAGGCCCAGTACTGCCAGCTGGTGCGACAGCTGCTGGATGACCACAAGG ATGTGGTGACCCTCTTGGCAGAGGGCCTACGTGAGAGCCGGAAGCACATAGAGGATGAAAAGCTCGTCCG CTACTTCTTGGACAAGACGCTGACTTCGAGGCTTGGAATCCGCATGTTGGCCACGCATCACCTGGCGCTG CATGAGGACAAGCCTGACTTTGTCGGCATCATCTGTACTCGTCTCTCACCAAAGAAGATTATTGAGAAGT GGGTGGACTTTGCCAGACGCCTGTGTGAGCACAAGTATGGCAATGCGCCCCGTGTCCGCATCAATGGCCA TGTGGCTGCCCGGTTCCCCTTCATCCCTATGCCACTGGACTACATCCTGCCGGAGCTGCTCAAGAATGCC ATGAGAGCCACAATGGAGAGTCACCTAGACACTCCCTACAATGTCCCAGATGTGGTCATCACCATCGCCA ACAATGATGTCGATCTGATCATCAGGATCTCAGACCGTGGTGGAGGAATCGCTCACAAAGATCTGGACCG GGTCATGGACTACCACTTCACTACTGCTGAGGCCAGCACACAGGACCCCCGGATCAGCCCCCTCTTTGGC CATCTGGACATGCATAGTGGCGCCCAGTCAGGACCCATGCACGGGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001122957 |
| ORF Size | 1098 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001122957.2, NP_001116429.1 |
| RefSeq Size | 2237 |
| RefSeq ORF | 1098 |
| Locus ID | 10295 |
| Protein Families | Druggable Genome, Protein Kinase |
| Gene Summary | The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) retains an intron in the 3' end of the coding sequence compared to variant 1. The resulting isoform (b) is shorter at the C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225553 | BCKDK (Myc-DDK-tagged)-Human branched chain ketoacid dehydrogenase kinase (BCKDK), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 420.00 |
|
| RG225553 | BCKDK (GFP-tagged) - Human branched chain ketoacid dehydrogenase kinase (BCKDK), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 460.00 |
|
| RC225553L3 | Lenti-ORF clone of BCKDK (Myc-DDK-tagged)-Human branched chain ketoacid dehydrogenase kinase (BCKDK), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 620.00 |
|
| RC225553L4 | Lenti-ORF clone of BCKDK (mGFP-tagged)-Human branched chain ketoacid dehydrogenase kinase (BCKDK), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China