Neuroserpin (SERPINI1) (NM_001122752) Human Untagged Clone
CAT#: SC318861
SERPINI1 (untagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2
"NM_001122752" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SERPINI1 |
Synonyms | neuroserpin; PI12 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001122752, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTCCTTGGACTCTTCTCTTTGCTGGTTCTGCAAAGTATGGCTACAGGGGCCACT TTCCCTGAGGAAGCCATTGCTGACTTGTCAGTGAATATGTATAATCGTCTTAGAGCCACT GGTGAAGATGAAAATATTCTCTTCTCTCCATTGAGTATTGCTCTTGCAATGGGAATGATG GAACTTGGGGCCCAAGGATCTACCCAGAAAGAAATCCGCCACTCAATGGGATATGACAGC CTAAAAAATGGTGAAGAATTTTCTTTCTTGAAGGAGTTTTCAAACATGGTAACTGCTAAA GAGAGCCAATATGTGATGAAAATTGCCAATTCCTTGTTTGTGCAAAATGGATTTCATGTC AATGAGGAGTTTTTGCAAATGATGAAAAAATATTTTAATGCAGCAGTAAATCATGTGGAC TTCAGTCAAAATGTAGCCGTGGCCAACTACATCAATAAGTGGGTGGAGAATAACACAAAC AATCTGGTGAAAGATTTGGTATCCCCAAGGGATTTTGATGCTGCCACTTATCTGGCCCTC ATTAATGCTGTCTATTTCAAGGGGAACTGGAAGTCGCAGTTTAGGCCTGAAAATACTAGA ACCTTTTCTTTCACTAAAGATGATGAAAGTGAAGTCCAAATTCCAATGATGTATCAGCAA GGAGAATTTTATTATGGGGAATTTAGTGATGGCTCCAATGAAGCTGGTGGTATCTACCAA GTCCTAGAAATACCATATGAAGGAGATGAAATAAGCATGATGCTGGTGCTGTCCAGACAG GAAGTTCCTCTTGCTACTCTGGAGCCATTAGTCAAAGCACAGCTGGTTGAAGAATGGGCA AACTCTGTGAAGAAGCAAAAAGTAGAAGTATACCTGCCCAGGTTCACAGTGGAACAGGAA ATTGATTTAAAAGATGTTTTGAAGGCTCTTGGAATAACTGAAATTTTCATCAAAGATGCA AATTTGACAGGCCTCTCTGATAATAAGGAGATTTTTCTTTCCAAAGCAATTCACAAGTCC TTCCTAGAGGTTAATGAAGAAGGCTCAGAAGCTGCTGCTGTCTCAGGAATGATTGCAATT AGTAGGATGGCTGTGCTGTATCCTCAAGTTATTGTCGACCATCCATTTTTCTTTCTTATC AGAAACAGGAGAACTGGTACAATTCTATTCATGGGACGAGTCATGCATCCTGAAACAATG AACACAAGTGGACATGATTTCGAAGAACTT |
Restriction Sites | Please inquire |
ACCN | NM_001122752 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001122752.1, NP_001116224.1 |
RefSeq Size | 1696 bp |
RefSeq ORF | 1233 bp |
Locus ID | 5274 |
Cytogenetics | 3q26.1 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | 'This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225640 | SERPINI1 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 |
USD 420.00 |
|
RG225640 | SERPINI1 (GFP-tagged) - Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 |
USD 460.00 |
|
RC225640L3 | Lenti-ORF clone of SERPINI1 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 |
USD 620.00 |
|
RC225640L4 | Lenti-ORF clone of SERPINI1 (mGFP-tagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review