GSTM3 (NM_000849) Human Untagged Clone

CAT#: SC319401

GSTM3 (untagged)-Human glutathione S-transferase mu 3 (brain) (GSTM3), transcript variant 1


  "NM_000849" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GSTM3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSTM3
Synonyms GST5; GSTB; GSTM3-3; GTM3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_000849.3 CGGAAGCCCGTCACCATGTCGTGCGAGTCGTCTATGGTTCTCGGGTACTGGGATATTCGT
GGGCTGGCGCACGCCATCCGCCTGCTCCTGGAGTTCACGGATACCTCTTATGAGGAGAAA
CGGTACACGTGCGGGGAAGCTCCTGACTATGATCGAAGCCAATGGCTGGATGTGAAATTC
AAGCTAGACCTGGACTTTCCTAATCTGCCCTACCTCCTGGATGGGAAGAACAAGATCACC
CAGAGCAATGCCATCTTGCGCTACATCGCTCGCAAGCACAACATGTGTGGTGAGACTGAA
GAAGAAAAGATTCGAGTGGACATCATAGAGAACCAAGTAATGGATTTCCGCACACAACTG
ATAAGGCTCTGTTACAGCTCTGACCACGAAAAACTGAAGCCTCAGTACTTGGAAGAGCTA
CCTGGACAACTGAAACAATTCTCCATGTTTCTGGGGAAATTCTCATGGTTTGCCGGGGAA
AAGCTCACCTTTGTGGATTTTCTCACCTATGATATCTTGGATCAGAACCGTATATTTGAC
CCCAAGTGCCTGGATGAGTTCCCAAACCTGAAGGCTTTCATGTGCCGTTTTGAGGCTTTG
GAGAAAATCGCTGCCTACTTACAGTCTGATCAGTTCTGCAAGATGCCCATCAACAACAAG
ATGGCCCAGTGGGGCAACAAGCCTGTATGCTGAGCAGGAGGCAGACTTGCAGAGCTTGTT
TTGTTTCATCCTGTCCGTAAGGGGTCAGCGCTCTTGCTTTGCTCTTTTCAATGAATAGCA
CTTATGTTACTGGTGTCCAGCTGAGTTTCTCTTGGGTATAAAGGCTAAAAGGGAAAAAGG
ATATGTGGAGAATCATCAAGATATGAATTGAATCGCTGCGATACTGGCATTTCCCTACTC
CCCAACTGAGTTCAAGGGCTGTAGGTTCATGCCCAAGCCCTGAGAGTGGGTACTAGAAAA
AACGAGATTGCACAGTTGGAGAGAGCAGGTGTGTTAAATGGGACTGGAGTCCCTGTGAAG
ACTGGGTGAGGATAACACAAGTAAAACTGTGGTACTGATGGACTTAACCGGAGTTCGGAA
ACCGTCCTGTGTACACATGGGAGTTTAGTGTGATAAAGGCAGTATTTCAGACTGGTGGGC
TAGCCAATAGAGTTGGGACAATTGCTTACTCATTAAAAATAATAGAGCCCCACTTGACAC
TATTCACTAAAATTAATCTGGAATTTAAGGCCCAACATTAAACACAAAGCTGTTGAAATA
AAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_000849
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000849.3, NP_000840.2
RefSeq Size 3948 bp
RefSeq ORF 678 bp
Locus ID 2947
Cytogenetics 1p13.3
Domains GST_N, GST_C
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary 'Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]'
Transcript Variant: This variant (1) represents the longer transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.