beta 1 Sodium Potassium ATPase (ATP1B1) (NM_001677) Human Untagged Clone
CAT#: SC319402
ATP1B1 (untagged)-Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1)
"NM_001677" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATP1B1 |
Synonyms | ATP1B |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001677.3
AGAAGCCGAGCGGCGCAGAGGACGCCAGGGCGCGCGCCGCAGCCACCCACCCTCCGGACC
GCGGCAGCTGCTGACCCGCCATCGCCATGGCCCGCGGGAAAGCCAAGGAGGAGGGCAGCT GGAAGAAATTCATCTGGAACTCAGAGAAGAAGGAGTTTCTGGGCAGGACCGGTGGCAGTT GGTTTAAGATCCTTCTATTCTACGTAATATTTTATGGCTGCCTGGCTGGCATCTTCATCG GAACCATCCAAGTGATGCTGCTCACCATCAGTGAATTTAAGCCCACATATCAGGACCGAG TGGCCCCGCCAGGATTAACACAGATTCCTCAGATCCAGAAGACTGAAATTTCCTTTCGTC CTAATGATCCCAAGAGCTATGAGGCATATGTACTGAACATAGTTAGGTTCCTGGAAAAGT ACAAAGATTCAGCCCAGAGGGATGACATGATTTTTGAAGATTGTGGCGATGTGCCCAGTG AACCGAAAGAACGAGGAGACTTTAATCATGAACGAGGAGAGCGAAAGGTCTGCAGATTCA AGCTTGAATGGCTGGGAAATTGCTCTGGATTAAATGATGAAACTTATGGCTACAAAGAGG GCAAACCGTGCATTATTATAAAGCTCAACCGAGTTCTAGGCTTCAAACCTAAGCCTCCCA AGAATGAGTCCTTGGAGACTTACCCAGTGATGAAGTATAACCCAAATGTCCTTCCCGTTC AGTGCACTGGCAAGCGAGATGAAGATAAGGATAAAGTTGGAAATGTGGAGTATTTTGGAC TGGGCAACTCCCCTGGTTTTCCTCTGCAGTATTATCCGTACTATGGCAAACTCCTGCAGC CCAAATACCTGCAGCCCCTGCTGGCCGTACAGTTCACCAATCTTACCATGGACACTGAAA TTCGCATAGAGTGTAAGGCGTACGGTGAGAACATTGGGTACAGTGAGAAAGACCGTTTTC AGGGACGTTTTGATGTAAAAATTGAAGTTAAGAGCTGATCACAAGCACAAATCTTTCCCA CTAGCCATTTAATAAGTTAAAAAAAGATACAAAAACAAAAACCTACTAGTCTTGAACAAA CTGTCATACGTATGGGACCTACACTTAATCTATATGCTTTACACTAGCTTTCTGCATTTA ATAGGTTAGAATGTAAATTAAAGTGTAGCAATAGCAACAAAATATTTATTCTACTGTAAA TGACAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001677 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001677.3, NP_001668.1 |
RefSeq Size | 2212 bp |
RefSeq ORF | 912 bp |
Locus ID | 481 |
Cytogenetics | 1q24.2 |
Domains | Na_K-ATPase |
Protein Families | Transmembrane |
Protein Pathways | Cardiac muscle contraction |
Gene Summary | 'The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 1 subunit. Alternatively spliced transcript variants encoding different isoforms have been described, but their biological validity is not known. [provided by RefSeq, Mar 2010]' Transcript Variant: This variant (1) represents the longer transcript, and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200500 | ATP1B1 (Myc-DDK-tagged)-Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1) |
USD 98.00 |
|
RG200500 | ATP1B1 (GFP-tagged) - Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1) |
USD 460.00 |
|
RC200500L1 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), Myc-DDK-tagged |
USD 768.00 |
|
RC200500L2 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), mGFP tagged |
USD 768.00 |
|
RC200500L3 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), Myc-DDK-tagged |
USD 768.00 |
|
RC200500L4 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review