HLAA (HLA-A) (NM_002116) Human Untagged Clone

CAT#: SC319417

HLA (untagged)-Human major histocompatibility complex, class I, A (HLA-A)


  "NM_002116" in other vectors (6)

Reconstitution Protocol

USD 630.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "HLA-A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HLA-A
Synonyms HLAA
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002116.5 GGCACGAGGGATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCT
GGCCCTGACCCAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTC
CCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTT
CGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGA
GCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGAC
TGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCA
CACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTA
CCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTG
GACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGC
GGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGA
GAACGGGAAGGAGACGCTGCAGCGCACGGACCCCCCCAAGACACATATGACCCACCACCC
CATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGAT
CACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGAC
CAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGA
GGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAG
ATGGGAGCTGTCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCT
CCTTGGAGCTGTGATCACTGGAGCTGTGGTCGCTGCCGTGATGTGGAGGAGGAAGAGCTC
AGATAGAAAAGGAGGGAGTTACACTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGA
TGTGTCTCTCACAGCTTGTAAAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAG
AGTTGTTCCTGCCCTTCCCTTTGTGACTTGAAGAACCCTGACTTTGTTTCTGCAAAGGCA
CCTGCATGTGTCTGTGTTCGTGTAGGCATAATGTGAGGAGGTGGGGAGAGCACCCCACCC
CCATGTCCACCATGACCCTCTTCCCACGCTGACCTGTGCTCCCTCTCCAATCATCTTTCC
TGTTCCAGAGAGGTGGGGCTGAGGTGTCTCCATCTCTGTCTCAACTTCATGGTGCACTGA
GCTGTAACTTCTTCCTTCCCTATTAAAATTAGAACCTGAGTATAAAAAAAAAAAAAAAAA
AAA
Restriction Sites Please inquire     
ACCN NM_002116
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002116.5, NP_002107.3
RefSeq Size 1538 bp
RefSeq ORF 1098 bp
Locus ID 3105
Cytogenetics 6p22.1
Domains MHC_I, ig, IGc1
Protein Families Transmembrane
Protein Pathways Allograft rejection, Antigen processing and presentation, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Endocytosis, Graft-versus-host disease, Natural killer cell mediated cytotoxicity, Type I diabetes mellitus, Viral myocarditis
Gene Summary 'HLA-A belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen so that they can be recognized by cytotoxic T cells. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. More than 6000 HLA-A alleles have been described. The HLA system plays an important role in the occurrence and outcome of infectious diseases, including those caused by the malaria parasite, the human immunodeficiency virus (HIV), and the severe acute respiratory syndrome coronavirus (SARS-CoV). The structural spike and the nucleocapsid proteins of the novel coronavirus SARS-CoV-2, which causes coronavirus disease 2019 (COVID-19), are reported to contain multiple Class I epitopes with predicted HLA restrictions. Individual HLA genetic variation may help explain different immune responses to a virus across a population.[provided by RefSeq, Aug 2020]'
Transcript Variant: This variant (1) represents the A*03:01:0:01 allele of the HLA-A gene, as found in the primary assembly of the reference genome.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.