KIR2DL4 (NM_001080772) Human Untagged Clone

CAT#: SC319875

KIR2DL4 (untagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), transcript variant 2


  "NM_001080772" in other vectors (4)

Reconstitution Protocol

USD 660.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "KIR2DL4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KIR2DL4
Synonyms CD158D; G9P; KIR-2DL4; KIR-103AS; KIR103; KIR103AS
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001080772.1 GTCGAGCCGAGTCACTGCGTCCTGGCAGCAGAAGCTGCACCATGTCCATGTCACCCACGG
TCATCATCCTGGCATGTCTTGGGTTCTTCTTGGACCAGAGTGTGTGGGCACACGTGGGTG
GTCAGGACAAGCCCTTCTGCTCTGCCTGGCCCAGCGCTGTGGTGCCTCAAGGAGGACACG
TGACTCTTCGGTGTCACTATCGTCGTGGGTTTAACATCTTCACGCTGTACAAGAAAGATG
GGGTCCCTGTCCCTGAGCTCTACAACAGAATATTCTGGAACAGTTTCCTCATTAGCCCTG
TGACCCCAGCACACGCAGGGACCTACAGATGTCGAGGTTTTCACCCGCACTCCCCCACTG
AGTGGTCGGCACCCAGCAACCCCCTGGTGATCATGGTCACAGGTCTATATGAGAAACCTT
CGCTTACAGCCCGGCCGGGCCCCACGGTTCGCACAGGAGAGAACGTGACCTTGTCCTGCA
GCTCCCAGAGCTCCTTTGACATCTACCATCTATCCAGGGAGGGGGAAGCCCATGAACTTA
GGCTCCCTGCAGTGCCCAGCATCAATGGAACATTCCAGGCCGACTTCCCTCTGGGTCCTG
CCACCCACGGAGAGACCTACAGATGCTTCGGCTCTTTCCATGGATCTCCCTACGAGTGGT
CAGACGCGAGTGACCCACTGCCTGTTTCTGTCACAGGAAACCCTTCTAGTAGTTGGCCTT
CACCCACTGAACCAAGCTTCAAAACTGGTATCGCCAGACACCTGCATGCTGTGATTAGGT
ACTCAGTGGCCATCATCCTCTTCACCATCCTTCCCTTCTTTCTCCTTCATCGCTGGTGCT
CCAAAAAAAAAAATGCTGCTGTAATGAACCAAGAGCCTGCGGGACACAGAACAGTGAACA
GGGAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGCACAGTTGGATCACTGCA
TTTTCACACAGAGAAAAATCACTGGCCCTTCTCAGAGGAGCAAGAGACCCTCAACAGATA
CCAGCGTGTGTATAGAACTTCCAAATGCTGAGCCCAGAGCGTTATCTCCTGCCCATGAGC
ACCACAGTCAGGCCTTGATGGGATCTTCTAGGGAGACAACAGCCCTGTCTCAAACCCAGC
TTGCCAGCTCTAATGTACCAGCAGCTGGAATCTGAAGGCGTGAGTCTCCATCTTAGAGCA
TCACTCTTCCTCACACCACAAATCTGGTGCCTGTCTCTTGCTTACCAATGTCTAAGGTCC
CCACTGCCTGCTGCAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCTATTTCACT
TGACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAA
TCACACTGAGGAACTCACAATTCCAAACATACAAGAGGCTCTCTATTAACACGGCACTTA
GACACGTGCTGTTCCACCTTCCCTCGTGCTGTTCCACCTTTCCTCAGACTATTTTTCAGC
CTTCTGGCATCAGCAAACCTTATAAAATTTTTTTGATTTCAGTGTAGTTCTCTCCTCTTC
AAATAAACATGTCTGCCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001080772
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001080772.1, NP_001074241.1
RefSeq Size 1609 bp
RefSeq ORF 822 bp
Locus ID 3805
Cytogenetics 19q13.42
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Natural killer cell mediated cytotoxicity
Gene Summary 'Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the "framework" loci that is present on all haplotypes. Alternate alleles of this gene are represented on multiple alternate reference loci (ALT_REF_LOCs). Alternative splicing results in multiple transcript variants, some of which may not be annotated on the primary reference assembly. [provided by RefSeq, Jul 2016]'
Transcript Variant: This variant (2) is one nt shorter than variant 1. It encodes isoform b, which is shorter and has a distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.