TM4SF4 (NM_004617) Human Untagged Clone
CAT#: SC320227
TM4SF4 (untagged)-Human transmembrane 4 L six family member 4 (TM4SF4)
"NM_004617" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TM4SF4 |
Synonyms | il-TMP; ILTMP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004617.2
GGCACGAGGGAAGCAACTCCAAGGACACAGTTCACAGAAATTTGGTTCTCAGCCCCAAAA
TACTGATTGAATTGGAGACAATTACAAGGACTCTCTGGCCAAAAACCCTTGAAGAGGCCC CGTGAAGGAGGCAGTGAGGAGCTTTTGATTGCTGACCTGTGTCGTACCACCCCAGAATGT GCACTGGGGGCTGTGCCAGATGCCTGGGGGGGACCCTCATTCCCCTTGCTTTTTTTGGCT TCCTGGCTAACATCCTGTTATTTTTTCCTGGAGGAAAAGTGATAGATGACAACGACCACC TTTCCCAAGAGATCTGGTTTTTCGGAGGAATATTAGGAAGCGGTGTCTTGATGATCTTCC CTGCGCTGGTGTTCTTGGGCCTGAAGAACAATGACTGCTGTGGGTGCTGCGGCAACGAGG GCTGTGGGAAGCGATTTGCGATGTTCACCTCCACGATATTTGCTGTGGTTGGATTCTTGG GAGCTGGATACTCGTTTATCATCTCAGCCATTTCAATCAACAAGGGTCCTAAATGCCTCA TGGCCAATAGTACATGGGGCTACCCCTTCCACGACGGGGATTATCTCAATGATGAGGCCT TATGGAACAAGTGCCGAGAGCCTCTCAATGTGGTTCCCTGGAATCTGACCCTCTTCTCCA TCCTGCTGGTCGTAGGAGGAATCCAGATGGTTCTCTGCGCCATCCAGGTGGTCAATGGCC TCCTGGGGACCCTCTGTGGGGACTGCCAGTGTTGTGGCTGCTGTGGGGGAGATGGACCCG TTTAAACCTCCGAGATGAGCTGCTCAGACTCTACAGCATGACGACTACAATTTCTTTTCA TAAAACTTCTTCTCTTCTTGGAATTATTAATTCCTATCTGCTTCCTAGCTGATAAAGCTT AGAAAAGGCAGTTATTCCTTCTTTCCAACCAGCTTTGCTCGAGTTAGAATTTTGTTATTT TCAAATAAAAAATAGTTTGGCCACTTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004617 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004617.2, NP_004608.1 |
RefSeq Size | 1428 bp |
RefSeq ORF | 609 bp |
Locus ID | 7104 |
Cytogenetics | 3q25.1 |
Protein Families | Transmembrane |
Gene Summary | 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that can regulate cell proliferation.[provided by RefSeq, Mar 2011]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200346 | TM4SF4 (Myc-DDK-tagged)-Human transmembrane 4 L six family member 4 (TM4SF4) |
USD 98.00 |
|
RG200346 | TM4SF4 (GFP-tagged) - Human transmembrane 4 L six family member 4 (TM4SF4) |
USD 460.00 |
|
RC200346L1 | Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), Myc-DDK-tagged |
USD 768.00 |
|
RC200346L2 | Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), mGFP tagged |
USD 768.00 |
|
RC200346L3 | Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), Myc-DDK-tagged |
USD 768.00 |
|
RC200346L4 | Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review