Ubiquitin (UBB) (NM_018955) Human Untagged Clone

CAT#: SC320597

UBB (untagged)-Human ubiquitin B (UBB)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBB
• Synonyms: HEL-S-50
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_018955.2 CACTCGTTGCATAAATTTGCGCTCCGCCAGCCCGGAGCATTTAGGGGCGGTTGGCTTTGT
  TGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGGTGATTGGCAGGATCCTGGT
  ATCCGCTAACAGGTCAAAATGCAGATCTTCGTGAAAACCCTTACCGGCAAGACCATCACC
  CTTGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAGGATAAGGAA
  GGCATTCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGACGGCCGT
  ACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCACCTGGTCCTGCGTCTGAGA
  GGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCATCACCCTGGAAGTGGAG
  CCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCC
  GACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTTTCTGAC
  TACAACATCCAGAAGGAGTCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAG
  ATCTTCGTGAAGACCCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACC
  ATCGAAAATGTGAAGGCCAAGATCCAAGATAAAGAAGGCATCCCCCCCGACCAGCAGAGG
  CTCATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAG
  AAAGAGTCGACCCTGCACCTGGTCCTGCGCCTGAGGGGTGGCTGTTAATTCTTCAGTCAT
  GGCATTCGCAGTGCCCAGTGATGGCATTACTCTGCACTATAGCCATTTGCCCCAACTTAA
  GTTTAGAAATTACAAGTTTCAGTAATAGCTGAACCTGTTCAAAATGTTAATAAAGGTTTC
  GTTGCATGGTAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_018955
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_018955.2, NP_061828.1
• RefSeq Size: 971 bp
• RefSeq ORF: 690 bp
• Locus ID: 7314
• Cytogenetics: 17p11.2
• Domains: UBQ
• Protein Families: Druggable Genome
• Protein Pathways: Parkinson's disease
• Gene Summary: 'This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of three direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. An aberrant form of this protein has been detected in patients with Alzheimer's disease and Down syndrome. Pseudogenes of this gene are located on chromosomes 1, 2, 13, and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]'
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3, 4, 5, and 6 encode the same protein.