EEF1B2 (NM_021121) Human Untagged Clone

CAT#: SC321566

EEF1B2 (untagged)-Human eukaryotic translation elongation factor 1 beta 2 (EEF1B2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EEF1B2
• Synonyms: EEF1B; EEF1B1; EF1B
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021121.3 TTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCGGGAGCCGTGGAGCTC
  TCGGATACAGCCGACACCATGGGTTTCGGAGACCTGAAAAGCCCTGCCGGCCTCCAGGTG
  CTCAACGATTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTGCCATCACAAGCAGAT
  GTGGCAGTATTTGAAGCCGTGTCCAGCCCACCGCCTGCCGACTTGTGTCATGCCCTACGT
  TGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCAGGAGTGAAGAAA
  GCTTTGGGCAAATATGGTCCTGCCGATGTGGAAGACACTACAGGAAGTGGAGCTACAGAT
  AGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAGGAGGAAAGTGAAGAA
  GCAAAGAGGCTAAGGGAAGAACGTCTTGCACAATATGAATCAAAGAAAGCCAAAAAACCT
  GCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAGAT
  ATGGCGAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCTCA
  TCTAAACTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTTGAA
  GATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTG
  CAGTCCATGGATGTGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCATGGCATTT
  AAATAAAAGATTGAAAGATTAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_021121
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021121.3, NP_066944.1
• RefSeq Size: 854 bp
• RefSeq ORF: 678 bp
• Locus ID: 1933
• Cytogenetics: 2q33.3
• Domains: EF1BD
• Gene Summary: 'This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) has a distinct 5' UTR compared to variants 1 and 3. Variants 1, 2 and 3 encode the same protein.