Proteasome 20S beta 6 (PSMB6) (NM_002798) Human Untagged Clone
CAT#: SC322188
PSMB6 (untagged)-Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6)
"NM_002798" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PSMB6 |
Synonyms | DELTA; LMPY; Y |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322188
CAGTACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCA
CCGGCTTGGGGGCCGGAGGCGTTCACTCCAGACTGGGAAAGCCGAGAAGTTTCCACTGGG ACCACTATCATGGCCGTGCAGTTTGACGGGGGCGTGGTTCTGGGGGCGGACTCCAGAACA ACCACTGGGTCCTACATCGCCAATCGAGTGACTGACAAGCTGACACCTATTCACGACCGC ATTTTCTGCTGTCGCTCAGGCTCAGCTGCTGATACCCAGGCAGTAGCTGATGCTGTCACC TACCAGCTCGGTTTCCACAGCATTGAACTGAATGAGCCTCCACTGGTCCACACAGCAGCC AGCCTCTTTAAGGAGATGTGTTACCGATACCGGGAAGACCTGATGGCGGGAATCATCATC GCAGGCTGGGACCCTCAAGAAGGAGGGCAGGTGTACTCAGTGCCTATGGGGGGTATGATG GTAAGGCAGTCCTTTGCCATTGGAGGCTCCGGGAGCTCCTACATCTATGGCTATGTTGAT GCTACCTACCGGGAAGGCATGACCAAGGAAGAGTGTCTGCAATTCACTGCCAATGCTCTC GCTTTGGCCATGGAGCGGGATGGCTCCAGTGGAGGAGTGATCCGCCTGGCAGCCATTGCA GAGTCAGGGGTAGAGCGGCAAGTACTTTTGGGAGACCAGATACCCAAATTCGCCGTTGCC ACTTTACCACCCGCCTGAATCCTGGGATTCTAGTATGCAATAAGAGATGCCCTGTACTGA TGCAAAATTTAATAAAGTTTGTCACAGAGAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002798 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002798.1, NP_002789.1 |
RefSeq Size | 849 bp |
RefSeq ORF | 720 bp |
Locus ID | 5694 |
Cytogenetics | 17p13.2 |
Domains | proteasome |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Proteasome |
Gene Summary | 'The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]' Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC101180 | PSMB6 (untagged)-Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6) |
USD 420.00 |
|
RC201605 | PSMB6 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6) |
USD 98.00 |
|
RG201605 | PSMB6 (GFP-tagged) - Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6) |
USD 460.00 |
|
RC201605L1 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6), Myc-DDK-tagged |
USD 768.00 |
|
RC201605L2 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6), mGFP tagged |
USD 620.00 |
|
RC201605L3 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6), Myc-DDK-tagged |
USD 620.00 |
|
RC201605L4 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review