GRO alpha (CXCL1) (NM_001511) Human Untagged Clone
CAT#: SC322326
CXCL1 (untagged)-Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1)
"NM_001511" in other vectors (7)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CXCL1 |
| Synonyms | FSP; GRO1; GROa; MGSA; MGSA-a; NAP-3; SCYB1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322326
GCCGCAGGCACCTCCTCGCCAGCTCTTCCGCTCCTCTCACAGCCGCCAGACCCGCCTGCT
GAGCCCCATGGCCCGCGCTGCTCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGAGT GGCACTGCTGCTCCTGCTCCTGGTAGCCGCTGGCCGGCGCGCAGCAGGAGCGTCCGTGGC CACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCCCAAGAACATCCA AAGTGTGAACGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACT CAAGAATGGGCGGAAAGCTTGCCTCAATCCTGCATCCCCCATAGTTAAGAAAATCATCGA AAAGATGCTGAACAGTGACAAATCCAACTGACCAGAAGGGAGGAGGAAGCTCACTGGTGG CTGTTCCTGAAGGAGGCCCTGCCCTTATAGGAACAGAAGAGGAAAGAGAGACACAGCTGC AGAGGCCACCTGGATTGTGCCTAATGTGTTTGAGCATCGCTTAGGAGAAGTCTTCTATTT ATTTATTTATTCATTAGTTTTGAAGATTCTATGTTAATATTTTAGGTGTAAAATAATTAA GGGTATGATTAACTCTACCTGCACACTGTCCTATTATATTCATTCTTTTTGAAATGTCAA CCCCAAGTTAGTTCAATCTGGATTCATATTTAATTTGAAGGTAGAATGTTTTCAAATGTT CTCCAGTCATTATGTTAATATTTCTGAGGAGCCTGCAACATGCCAGCCACTGTGATAGAG GCTGGCGGATCCAAGCAAATGGCCAATGAGATCATTGTGAAGGCAGGGGAATGTATGTGC ACATCTGTTTTGTAACTGTTTAGATGAATGTCAGTTGTTATTTATTGAAATGATTTCACA GTGTGTGGTCAACATTTCTCATGTTGAAACTTTAAGAACTAAAATGTTCTAAATATCCCT TGGACATTTTATGTCTTTCTTGTAAGGCATACTGCCTTGTTTAATGGTAGTTTTACAGTG TTTCTGGCTTAGAACAAAGGGGCTTAATTATTGATGTTTTCATAGAGAATATAAAAATAA AGCCCTTATAGAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001511 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001511.1, NP_001502.1 |
| RefSeq Size | 1103 bp |
| RefSeq ORF | 324 bp |
| Locus ID | 2919 |
| Cytogenetics | 4q13.3 |
| Domains | IL8 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Epithelial cell signaling in Helicobacter pylori infection, NOD-like receptor signaling pathway |
| Gene Summary | 'This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]' Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC119178 | CXCL1 (untagged)-Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1) |
USD 540.00 |
|
| RC201992 | CXCL1 (Myc-DDK-tagged)-Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1) |
USD 420.00 |
|
| RG201992 | CXCL1 (GFP-tagged) - Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1) |
USD 460.00 |
|
| RC201992L1 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1), Myc-DDK-tagged |
USD 768.00 |
|
| RC201992L2 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1), mGFP tagged |
USD 620.00 |
|
| RC201992L3 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1), Myc-DDK-tagged |
USD 768.00 |
|
| RC201992L4 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China