SURF1 (NM_003172) Human Untagged Clone

CAT#: SC322743

SURF1 (untagged)-Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein


  "NM_003172" in other vectors (7)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SURF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SURF1
Synonyms CMT4K
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322743 CCCACGCGTCCGGGAAGCGCCCGCGGGGCCGGGTGCGATGGCGGCGGTGGCTGCGTTGCA
GCTGGGGCTGCGGGCGGCGGGGCTGGGACGGGCCCCGGCCAGCGCCGCCTGGAGGAGCGT
CCTCAGGGTCTCCCCGCGCCCAGGGGTGGCCTGGAGGCCAAGCAGATGTGGCAGTTCTGC
AGCAGAAGCATCTGCCACAAAAGCGGAAGATGACTCCTTTCTTCAGTGGGTCCTGCTCCT
CATCCCTGTGACTGCCTTTGGCTTGGGGACATGGCAGGTCCAGCGTCGGAAGTGGAAGCT
GAACCTGATTGCAGAGCTGGAGTCCAGAGTTCTGGCTGAGCCTGTCCCTCTGCCAGCCGA
CCCAATGGAACTGAAAAATCTGGAGTATAGGCCAGTGAAGGTCAGGGGGTGCTTTGACCA
TTCCAAGGAGCTGTATATGATGCCCCGGACCATGGTGGACCCTGTCCGGGAGGCCCGGGA
GGGCGGCCTCATCTCCTCCTCAACTCAGAGTGGGGCCTATGTGGTCACTCCCTTCCACTG
CACCGACCTGGGAGTCACCATCCTGGTAAATAGAGGGTTCGTTCCCAGGAAGAAAGTGAA
TCCTGAAACGCGGCAGAAAGGCCAGATTGAGGGAGAAGTGGACCTCATTGGGATGGTGAG
GCTGACAGAAACCAGGCAGCCTTTTGTCCCTGAGAACAATCCAGAAAGGAACCACTGGCA
TTATCGAGACCTGGAAGCTATGGCCAGAATCACAGGCGCAGAGCCCATCTTCATTGATGC
CAACTTCCAGAGCACAGTCCCTGGAGGACCCATTGGAGGGCAAACCAGAGTTACTCTGAG
GAACGAGCATCTGCAGTACATCGTGACCTGGTATGGACTCTCTGCAGCTACATCCTACCT
GTGGTTTAAGAAATTCCTACGTGGGACACCTGGTGTGTGACAGATCAGCTGCTGAAGCCC
TGTCCCTGGATAATGCAGTATTTCAAGACTGCCTTTATGCTGGATCATGTGCTACTGGTA
TAAAGTTCTGGCCTTCTACCTTAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_003172
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003172.2, NP_003163.1
RefSeq Size 1037 bp
RefSeq ORF 903 bp
Locus ID 6834
Cytogenetics 9q34.2
Domains SURF1
Protein Families Druggable Genome
Gene Summary 'This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.