SURF1 (NM_003172) Human Untagged Clone
CAT#: SC322743
SURF1 (untagged)-Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein
"NM_003172" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SURF1 |
Synonyms | CMT4K |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322743
CCCACGCGTCCGGGAAGCGCCCGCGGGGCCGGGTGCGATGGCGGCGGTGGCTGCGTTGCA
GCTGGGGCTGCGGGCGGCGGGGCTGGGACGGGCCCCGGCCAGCGCCGCCTGGAGGAGCGT CCTCAGGGTCTCCCCGCGCCCAGGGGTGGCCTGGAGGCCAAGCAGATGTGGCAGTTCTGC AGCAGAAGCATCTGCCACAAAAGCGGAAGATGACTCCTTTCTTCAGTGGGTCCTGCTCCT CATCCCTGTGACTGCCTTTGGCTTGGGGACATGGCAGGTCCAGCGTCGGAAGTGGAAGCT GAACCTGATTGCAGAGCTGGAGTCCAGAGTTCTGGCTGAGCCTGTCCCTCTGCCAGCCGA CCCAATGGAACTGAAAAATCTGGAGTATAGGCCAGTGAAGGTCAGGGGGTGCTTTGACCA TTCCAAGGAGCTGTATATGATGCCCCGGACCATGGTGGACCCTGTCCGGGAGGCCCGGGA GGGCGGCCTCATCTCCTCCTCAACTCAGAGTGGGGCCTATGTGGTCACTCCCTTCCACTG CACCGACCTGGGAGTCACCATCCTGGTAAATAGAGGGTTCGTTCCCAGGAAGAAAGTGAA TCCTGAAACGCGGCAGAAAGGCCAGATTGAGGGAGAAGTGGACCTCATTGGGATGGTGAG GCTGACAGAAACCAGGCAGCCTTTTGTCCCTGAGAACAATCCAGAAAGGAACCACTGGCA TTATCGAGACCTGGAAGCTATGGCCAGAATCACAGGCGCAGAGCCCATCTTCATTGATGC CAACTTCCAGAGCACAGTCCCTGGAGGACCCATTGGAGGGCAAACCAGAGTTACTCTGAG GAACGAGCATCTGCAGTACATCGTGACCTGGTATGGACTCTCTGCAGCTACATCCTACCT GTGGTTTAAGAAATTCCTACGTGGGACACCTGGTGTGTGACAGATCAGCTGCTGAAGCCC TGTCCCTGGATAATGCAGTATTTCAAGACTGCCTTTATGCTGGATCATGTGCTACTGGTA TAAAGTTCTGGCCTTCTACCTTAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003172 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003172.2, NP_003163.1 |
RefSeq Size | 1037 bp |
RefSeq ORF | 903 bp |
Locus ID | 6834 |
Cytogenetics | 9q34.2 |
Domains | SURF1 |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC111028 | SURF1 (untagged)-Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein |
USD 310.00 |
|
RC209918 | SURF1 (Myc-DDK-tagged)-Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein |
USD 420.00 |
|
RG209918 | SURF1 (GFP-tagged) - Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein |
USD 460.00 |
|
RC209918L1 | Lenti ORF clone of Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 768.00 |
|
RC209918L2 | Lenti ORF clone of Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
|
RC209918L3 | Lenti ORF clone of Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 620.00 |
|
RC209918L4 | Lenti ORF clone of Human surfeit 1 (SURF1), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review