SURF4 (NM_033161) Human Untagged Clone
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | SURF4 |
| Synonyms | ERV29 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_033161, the custom clone sequence may differ by one or more nucleotides
ATGGGCCAGAACGACCTGATGGGCACGGCCGAGGACTTCGCCGACCAGTTCCTCCGTGTCACAAAGCAGT ACCTGCCCCACGTGGCGCGCCTCTGTCTGATCAGCACCTTCCTGGAGGACGGCATCCGTATGTGGTTCCA GTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGCGGCTACCTGCTGGCCTCGTCCTTCGTC TTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTGTTGAGCAGGAACTTCGTGCAGTACGCCT GCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCCTACAGCATTTTATGGGACTTGAAGTTTTT GATGAGGAACCTGGCCCTGGGAGGAGGCCTGTTGCTGCTCCTAGCAGAATCCCGTTCTGAAGGGAAGAGC ATGTTTGCGGGCGTCCCCACCATGCGTGAGAGCTCCCCCAAACAGTACATGCAGCTCGGAGGCAGGGTCT TGCTGGTTCTGATGTTCATGACCCTCCTTCACTTTGACGCCAGCTTCTTTTCTATTGTCCAGAACATCGT GGGCACAGCTCTGATGATTTTAGTGGCCATTGGTTTTAAAACCAAGCTGGCTGCTTTGACTCTTGTTGTG TGGCTCTTTGCCATCAACGTATATTTCAACGCCTTCTGGACCATTCCAGTCTACAAGCCCATGCATGACT TCCTGAAATACGACTTCTTCCAGACCATGTCGGTGATTGGGGGCTTGCTCCTGGTGGTGGCCCTGGGCCC TGGGGGTGTCTCCATGGATGAGAAGAAGAAGGAGTGGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_033161 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_033161.2, NP_149351.1 |
| RefSeq Size | 2985 bp |
| RefSeq ORF | 810 bp |
| Locus ID | 6836 |
| Cytogenetics | 9q34.2 |
| Domains | SURF4 |
| Protein Families | Transmembrane |
| Gene Summary | 'This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]' Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC128236 | SURF4 (untagged)-Human surfeit 4 (SURF4) |
USD 310.00 |
|
| RC210315 | SURF4 (Myc-DDK-tagged)-Human surfeit 4 (SURF4) |
USD 300.00 |
|
| RG210315 | SURF4 (GFP-tagged) - Human surfeit 4 (SURF4) |
USD 460.00 |
|
| RC210315L1 | Lenti ORF clone of Human surfeit 4 (SURF4), Myc-DDK-tagged |
USD 768.00 |
|
| RC210315L2 | Lenti ORF clone of Human surfeit 4 (SURF4), mGFP tagged |
USD 620.00 |
|
| RC210315L3 | Lenti ORF clone of Human surfeit 4 (SURF4), Myc-DDK-tagged |
USD 620.00 |
|
| RC210315L4 | Lenti ORF clone of Human surfeit 4 (SURF4), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China