Bcl2 Binding component 3 (BBC3) (NM_001127242) Human Untagged Clone

CAT#: SC322807

BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BBC3
• Synonyms: JFY-1; JFY1; PUMA
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127242, the custom clone sequence may differ by one or more nucleotides
  ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC
  ACGACGTGGGTCCCCTGCCAGATTTGTGAGACAAGAGGAGCAGCAGCGGCACCGCCCCTC
  ACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAG
  AGCCCCCGAGATGGAGCCCAATTAGGTGCCTGCACCCGCCCGGTGGACGTCAGGGACTCG
  GGGGGCAGGCCCCTCCCACCTCCTGACACCCTGGCCAGCGCGGGGGACTTTCTCTGCACC
  ATG
  
• Restriction Sites: Please inquire
• ACCN: NM_001127242
• ORF Size: 1359 bp
• Insert Size: 1359
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001127242.1, NP_001120714.1
• RefSeq Size: 1359
• RefSeq ORF: 1359
• Locus ID: 27113
• Protein Families: Druggable Genome
• Protein Pathways: Huntington's disease, p53 signaling pathway
• Gene Summary: This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) lacks two exons spanning the 5' and central coding regions, resulting in a frameshift in the 3' coding region, compared to variant 2. The encoded isoform (3, also known as PUMA-delta) has the same N-terminus but is otherwise distinct and shorter, compared to isoform 2.