BEX4 (NM_001127688) Human Untagged Clone

CAT#: SC322819

BEX4 (untagged)-Human brain expressed, X-linked 4 (BEX4)


  "NM_001127688" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "BEX4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BEX4
Synonyms BEXL1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001127688, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCCAAAGAGGAACTAGCGGCAAACAATCTCAACGGGGAAAATGCCCAACAAGAA
AACGAAGGAGGGGAGCAGGCCCCCACGCAGAATGAAGAAGAATCCCGCCATTTGGGAGGG
GGTGAAGGCCAGAAGCCTGGAGGAAATATCAGGCGGGGGCGAGTTAGGCGACTTGTCCCT
AATTTTCGATGGGCCATACCTAATAGGCATATTGAGCACAATGAAGCGAGAGATGATGTA
GAAAGGTTTGTAGGGCAGATGATGGAAATCAAGAGAAAGACTAGGGAACAGCAGATGAGG
CACTATATGCGCTTCCAAACTCCTGAACCTGACAACCATTATGACTTTTGCCTCATACCT
Restriction Sites Please inquire     
ACCN NM_001127688
ORF Size 363 bp
Insert Size 1199
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001127688.1, NP_001121160.1
RefSeq Size 1199
RefSeq ORF 363
Locus ID 56271
Gene Summary This gene is a member of the brain expressed X-linked gene family. The proteins encoded by some of the other members of this family act as transcription elongation factors which allow RNA polymerase II to escape pausing during elongation. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.