BEX4 (NM_001127688) Human Untagged Clone
CAT#: SC322819
BEX4 (untagged)-Human brain expressed, X-linked 4 (BEX4)
"NM_001127688" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BEX4 |
Synonyms | BEXL1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001127688, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCCAAAGAGGAACTAGCGGCAAACAATCTCAACGGGGAAAATGCCCAACAAGAA AACGAAGGAGGGGAGCAGGCCCCCACGCAGAATGAAGAAGAATCCCGCCATTTGGGAGGG GGTGAAGGCCAGAAGCCTGGAGGAAATATCAGGCGGGGGCGAGTTAGGCGACTTGTCCCT AATTTTCGATGGGCCATACCTAATAGGCATATTGAGCACAATGAAGCGAGAGATGATGTA GAAAGGTTTGTAGGGCAGATGATGGAAATCAAGAGAAAGACTAGGGAACAGCAGATGAGG CACTATATGCGCTTCCAAACTCCTGAACCTGACAACCATTATGACTTTTGCCTCATACCT |
Restriction Sites | Please inquire |
ACCN | NM_001127688 |
ORF Size | 363 bp |
Insert Size | 1199 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001127688.1, NP_001121160.1 |
RefSeq Size | 1199 |
RefSeq ORF | 363 |
Locus ID | 56271 |
Gene Summary | This gene is a member of the brain expressed X-linked gene family. The proteins encoded by some of the other members of this family act as transcription elongation factors which allow RNA polymerase II to escape pausing during elongation. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225057 | BEX4 (Myc-DDK-tagged)-Human brain expressed, X-linked 4 (BEX4) |
USD 420.00 |
|
RG225057 | BEX4 (GFP-tagged) - Human brain expressed, X-linked 4 (BEX4) |
USD 460.00 |
|
RC225057L3 | Lenti-ORF clone of BEX4 (Myc-DDK-tagged)-Human brain expressed, X-linked 4 (BEX4) |
USD 620.00 |
|
RC225057L4 | Lenti-ORF clone of BEX4 (mGFP-tagged)-Human brain expressed, X-linked 4 (BEX4) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review