Bcl2 Binding component 3 (BBC3) (NM_001127240) Human Untagged Clone

CAT#: SC322931

BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BBC3
• Synonyms: JFY-1; JFY1; PUMA
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001127240 edited
  ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC
  ACGACGTGGGTCCCCTGCCAGATTTGTGGCCCCAGGGAGCGCCATGGCCCGCGCACGCCA
  GGAGGGCAGCTCCCCGGAGCCCGTAGAGGGCCTGGCCCGCGACGGCCCGCGCCCCTTCCC
  GCTCGGCCGCCTGGTGCCCTCGGCAGTGTCCTGCGGCCTCTGCGAGCCCGGCCTGGCTGC
  CGCCCCCGCCGCCCCCACCCTGCTGCCCGCTGCCTACCTCTGCGCCCCCACCGCCCCACC
  CGCCGTCACCGCCGCCCTGGGGGGTTCCCGCTGGCCTGGGGGTCCCCGCAGCCGGCCCCG
  AGGCCCGCGCCCGGACGGTCCTCAGCCCTCGCTCTCGCTGGCGGAGCAGCACCTGGAGTC
  GCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACCCAGGCGGCCCCGGGAGT
  CCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCGGA
  CGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAGCAGCGGCACCGCCCCTC
  ACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAG
  AGCCCCCGAGATGGAGCCCAATTAGGTGCCTGCACCCGCCCGGTGGACGTCAGGGACTCG
  GGGGGCAGGCCCCTCCCACCTCCTGACACCCTGGCCAGCGCGGGGGACTTTCTCTGCACC
  ATGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001127240
• ORF Size: 786 bp
• Insert Size: 800
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001127240.1.

Reference Data

• RefSeq: NM_001127240.1, NP_001120712.1
• RefSeq Size: 1827
• RefSeq ORF: 786
• Locus ID: 27113
• Protein Families: Druggable Genome
• Protein Pathways: Huntington's disease, p53 signaling pathway
• Gene Summary: This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (1) includes an alternate exon in the 5' coding region, resulting in a frameshift for the remainder of the CDS, compared to variant 2. The encoded isoform (1, also known as PUMA-gamma) has the same N-terminus but is otherwise distinct and longer, compared to isoform 2.