Sprouty 4 (SPRY4) (NM_001127496) Human Untagged Clone

CAT#: SC322958

SPRY4 (untagged)-Human sprouty homolog 4 (Drosophila) (SPRY4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPRY4
• Synonyms: HH17
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127496, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCCCCGATCCCACAGAGCGCCCCCTTGACTCCCAACTCAGTCATGGTCCAGCCCCTTCTTGACA
  GCCGGATGTCCCACAGCCGGCTCCAGCACCCACTCACCATCCTACCCATTGACCAGGTGAAGACCAGCCA
  TGTGGAGAATGACTACATAGACAACCCTAGCCTGGCCCTGACCACCGGCCCAAAGCGGACCCGGGGCGGG
  GCCCCAGAGCTGGCCCCGACGCCCGCCCGCTGTGACCAGGATGTCACCCACCATTGGATCTCCTTCAGCG
  GGCGCCCCAGCTCTGTGAGCAGCAGCAGCAGCACATCCTCTGACCAACGGCTCTTAGACCACATGGCACC
  ACCACCCGTGGCTGACCAGGCCTCACCAAGGGCTGTGCGCATCCAGCCCAAGGTGGTCCACTGCCAGCCG
  CTGGACCTCAAGGGCCCGGCGGTCCCACCCGAGCTGGACAAGCACTTCTTGCTGTGCGAGGCCTGTGGGA
  AGTGTAAATGCAAGGAGTGTGCATCCCCCCGGACGTTGCCTTCCTGCTGGGTCTGCAACCAGGAGTGCCT
  GTGCTCAGCCCAGACTCTGGTCAACTATGGCACGTGCATGTGTTTGGTGCAGGGCATCTTCTACCACTGC
  ACGAATGAGGACGATGAGGGCTCCTGCGCTGACCACCCCTGCTCCTGCTCCCGCTCCAACTGCTGCGCCC
  GCTGGTCCTTCATGGGTGCTCTCTCCGTGGTGCTGCCCTGCCTGCTCTGCTACCTGCCTGCCACCGGCTG
  CGTGAAGCTGGCCCAGCGTGGCTACGACCGTCTGCGCCGCCCTGGTTGCCGCTGCAAGCACACGAACAGC
  GTCATCTGCAAAGCAGCCAGCGGGGATGCCAAGACCAGCAGGCCCGACAAGCCTTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127496
• ORF Size: 900 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001127496.1, NP_001120968.1
• RefSeq Size: 4941
• RefSeq ORF: 900
• Locus ID: 81848
• Protein Pathways: Jak-STAT signaling pathway
• Gene Summary: This gene encodes a member of a family of cysteine- and proline-rich proteins. The encoded protein is an inhibitor of the receptor-transduced mitogen-activated protein kinase (MAPK) signaling pathway. Activity of this protein impairs the formation of active GTP-RAS. Nucleotide variation in this gene has been associated with hypogonadotropic hypogonadism 17 with or without anosmia. Alternative splicing results in a multiple transcript variants. [provided by RefSeq, Jun 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, and 4 encode the same isoform (2).