TOMM40 (NM_001128917) Human Untagged Clone
CAT#: SC323000
TOMM40 (untagged)-Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1
"NM_001128917" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TOMM40 |
Synonyms | C19orf1; D19S1177E; PER-EC1; PEREC1; TOM40 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001128917, the custom clone sequence may differ by one or more nucleotides
ATGGGGAACGTGTTGGCTGCCAGCTCGCCGCCCGCAGGGCCGCCACCGCCGCCTGCGCCGGCCCTCGTGG GGCTGCCGCCACCTCCGCCCTCGCCGCCGGGCTTCACGCTGCCGCCGCTGGGAGGCAGCCTGGGCGCCGG CACCAGTACGAGTCGAAGTTCGGAACGGACCCCCGGGGCTGCAACCGCCAGCGCCTCAGGGGCCGCCGAG GATGGGGCCTGCGGCTGCCTGCCCAACCCGGGCACATTCGAGGAGTGCCACCGGAAGTGCAAGGAGCTGT TTCCCATTCAGATGGAGGGTGTCAAGCTCACAGTCAACAAAGGGTTGAGTAACCATTTTCAGGTCAACCA CACAGTAGCCCTCAGCACAATCGGGGAGTCCAACTACCACTTCGGGGTCACATATGTGGGGACAAAGCAG CTGAGTCCCACAGAGGCGTTCCCTGTACTGGTGGGTGACATGGACAACAGTGGCAGTCTCAACGCTCAGG TCATTCACCAGCTGGGCCCCGGTCTCAGGTCCAAGATGGCCATCCAGACCCAGCAGTCGAAGTTTGTGAA CTGGCAGGTGGACGGGGAGTATCGGGGCTCTGACTTCACAGCAGCCGTCACCCTGGGGAACCCAGACGTC CTCGTGGGTTCAGGAATCCTCGTAGCCCACTACCTCCAGAGCATCACGCCTTGCCTGGCCCTGGGTGGAG AGCTGGTCTACCACCGGCGGCCTGGAGAGGAGGGCACTGTCATGTCTCTAGCTGGGAAATACACATTGAA CAACTGGTTGGCAACGGTAACGTTGGGCCAGGCGGGCATGCACGCAACATACTACCACAAAGCCAGTGAC CAGCTGCAGGTGGGTGTGGAGTTTGAGGCCAGCACAAGGATGCAGGACACCAGCGTCTCCTTCGGGTACC AGCTGGACCTGCCCAAGGCCAACCTCCTCTTCAAAGGCTCTGTGGATAGCAACTGGATCGTGGGTGCCAC GCTGGAGAAGAAGCTCCCACCCCTGCCCCTGACACTGGCCCTTGGGGCCTTCCTGAATCACCGCAAGAAC AAGTTTCAGTGTGGCTTTGGCCTCACCATCGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001128917 |
ORF Size | 1086 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001128917.1, NP_001122389.1 |
RefSeq Size | 1819 |
RefSeq ORF | 1086 |
Locus ID | 10452 |
Protein Families | Druggable Genome, Ion Channels: Other |
Protein Pathways | Amyotrophic lateral sclerosis (ALS) |
Gene Summary | The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225543 | TOMM40 (Myc-DDK-tagged)-Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 420.00 |
|
RG225543 | TOMM40 (GFP-tagged) - Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 460.00 |
|
RC225543L1 | Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC225543L2 | Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC225543L3 | Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC225543L4 | Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review