LKB1 (STK11) (NM_000455) Human Untagged Clone

CAT#: SC323432

STK11 (untagged)-Kinase deficient mutant (K78M) of Human serine/threonine kinase 11 (STK11)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STK11
• Synonyms: hLKB1; LKB1; PJS
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_000455 edited
  ATGGAGGTGGTGGACCCGCAGCAGCTGGGCATGTTCACGGAGGGCGAGCTGATGTCGGTG
  GGTATGGACACGTTCATCCACCGCATCGACTCCACCGAGGTCATCTACCAGCCGCGCCGC
  AAGCGGGCCAAGCTCATCGGCAAGTACCTGATGGGGGACCTGCTGGGGGAAGGCTCTTAC
  GGCAAGGTGAAGGAGGTGCTGGACTCGGAGACGCTGTGCAGGAGGGCCGTCATGATCCTC
  AAGAAGAAGAAGTTGCGAAGGATCCCCAACGGGGAGGCCAACGTGAAGAAGGAAATTCAA
  CTACTGAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAA
  GAGAAGCAGAAAATGTATATGGTGATGGAGTACTGCGTGTGTGGCATGCAGGAAATGCTG
  GACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTG
  ATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGG
  AACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCA
  CTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAG
  CCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCG
  GCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATC
  TACAAGTTGTTTGAGAACATCGGGAAGGGGAGCTACGCCATCCCGGGCGACTGTGGCCCC
  CCGCTCTCTGACCTGCTGAAAGGGATGCTTGAGTACGAACCGGCCAAGAGGTTCTCCATC
  CGGCAGATCCGGCAGCACAGCTGGTTCCGGAAGAAACATCCTCCGGCTGAAGCACCAGTG
  CCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTAC
  TTGGAGGACCTGCACGGCGCGGACGAGGACGAGGACCTCTTCGACATCGAGGATGACATC
  ATCTACACTCAGGACTTCACGGTGCCCGGACAGGTCCCAGAAGAGGAGGCCAGTCACAAT
  GGACAGCGCCGGGGCCTCCCCAAGGCCGTGTGTATGAACGGCACAGAGGCGGCGCAGCTG
  AGCACCAAATCCAGGGCGGAGGGCCGGGCCCCCAACCCTGCCCGCAAGGCCTGCTCCGCC
  AGCAGCAAGATCCGCCGGCTGTCGGCCTGCAAGCAGCAGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_000455
• Insert Size: 2500 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000455.4, NP_000446.1
• RefSeq Size: 3286 bp
• RefSeq ORF: 1302 bp
• Locus ID: 6794
• Cytogenetics: 19p13.3
• Domains: pkinase, TyrKc, S_TKc
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Adipocytokine signaling pathway, mTOR signaling pathway
• Gene Summary: 'This gene, which encodes a member of the serine/threonine kinase family, regulates cell polarity and functions as a tumor suppressor. Mutations in this gene have been associated with Peutz-Jeghers syndrome, an autosomal dominant disorder characterized by the growth of polyps in the gastrointestinal tract, pigmented macules on the skin and mouth, and other neoplasms. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]'