TCTP (TPT1) (NM_003295) Human Untagged Clone
CAT#: SC323772
TPT1 (untagged)-Human tumor protein, translationally-controlled 1 (TPT1)
"NM_003295" in other vectors (7)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TPT1 |
| Synonyms | HRF; p02; p23; TCTP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003295.1
CCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCGAGTTTCAGGCTCGTGC
TAAGCTAGCGCCGTCGTCGTCTCCCTTCAGTCGCCATCATGATTATCTACCGGGACCTCA TCAGCCACGATGAGATGTTCTCCGACATCTACAAGATCCGGGAGATCGCGGACGGGTTGT GCCTGGAGGTGGAGGGGAAGATGGTCAGTAGGACAGAAGGTAACATTGATGACTCGCTCA TTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCA CTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCT ACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGAC CAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTA ATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTC TATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAG AAATGGAAAAATGTTAACAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAAC TGGCTTCTGCTTGTCATCCACACAACACCAGGACTTAAGACAAATGGGACTGATGTCATC TTGAGCTCTTCATTTATTTTGACTGTGATTTATTTGGAGTGGAGGCATTGTTTTTAAGAA AAACATGTCATGTAGGTTGTCTAAAAATAAAATGCATTTAAACTCAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_003295 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_003295.1, NP_003286.1 |
| RefSeq Size | 830 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 7178 |
| Cytogenetics | 13q14.13 |
| Domains | TCTP |
| Gene Summary | 'This gene encodes a protein that is a regulator of cellular growth and proliferation. Its mRNA is highly structured and contains an oligopyrimidine tract (5'-TOP) in its 5' untranslated region that functions to repress its translation under quiescent conditions. The encoded protein is involved in a variety of cellular pathways, including apoptosis, protein synthesis and cell division. It binds to and stabilizes microtubules, and removal of this protein through phosphorylation is required for progression through mitotic and meiotic cell divisions. This gene is known to play a role in carcinogenesis, and is upregulated in some cancer cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2017]' Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter C-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC118056 | TPT1 (untagged)-Human tumor protein, translationally-controlled 1 (TPT1) |
USD 310.00 |
|
| RC201664 | TPT1 (Myc-DDK-tagged)-Human tumor protein, translationally-controlled 1 (TPT1) |
USD 450.00 |
|
| RG201664 | TPT1 (GFP-tagged) - Human tumor protein, translationally-controlled 1 (TPT1) |
USD 460.00 |
|
| RC201664L1 | Lenti ORF clone of Human tumor protein, translationally-controlled 1 (TPT1), Myc-DDK-tagged |
USD 750.00 |
|
| RC201664L2 | Lenti ORF clone of Human tumor protein, translationally-controlled 1 (TPT1), mGFP tagged |
USD 750.00 |
|
| RC201664L3 | Lenti ORF clone of Human tumor protein, translationally-controlled 1 (TPT1), Myc-DDK-tagged |
USD 750.00 |
|
| RC201664L4 | Lenti ORF clone of Human tumor protein, translationally-controlled 1 (TPT1), mGFP tagged |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China