FKBP11 (NM_001143781) Human Untagged Clone

CAT#: SC324706

FKBP11 (untagged)-Human FK506 binding protein 11, 19 kDa (FKBP11), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FKBP11
• Synonyms: FKBP19
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143781, the custom clone sequence may differ by one or more nucleotides
  ATGTGTGTGGGAGAGAAGCGAAGGGCAATCATTCCTTCTCACTTGGCCTATGGAAAACGG
  GGATTTCCACCATCTGTCCCAGCGGATGCAGTGGTGCAGTATGACGTGGAGCTGATTGCA
  CTAATCCGAGCCAACTACTGGCTAAAGCTGGTGAAGGGCATTTTGCCTCTGGTAGGGATG
  GCCATGGTGCCAGCCCTCCTGGGCCTCATTGGGTATCACCTATACAGAAAGGCCAATAGA
  CCCAAAGTCTCCAAAAAGAAGCTCAAGGAAGAGAAACGAAACAAGAGCAAAAAGAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001143781
• ORF Size: 300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143781.1, NP_001137253.1
• RefSeq Size: 561
• RefSeq ORF: 300
• Locus ID: 51303
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: FKBP11 belongs to the FKBP family of peptidyl-prolyl cis/trans isomerases, which catalyze the folding of proline-containing polypeptides. The peptidyl-prolyl isomerase activity of FKBP proteins is inhibited by the immunosuppressant compounds FK506 and rapamycin (Rulten et al., 2006 [PubMed 16596453]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.