Apg10 (ATG10) (NM_001131028) Human Untagged Clone

CAT#: SC324798

ATG10 (untagged)-Human ATG10 autophagy related 10 homolog (S. cerevisiae) (ATG10), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATG10
• Synonyms: APG10; APG10L; pp12616
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001131028, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGAAGATGAGTTCATTGGAGAAAAAACATTCCAACGTTATTGTGCAGAATTCATTAAACATTCAC
  AACAGATAGGTGATAGTTGGGAATGGAGACCATCAAAGGACTGTTCTGATGGCTACATGTGCAAAATACA
  CTTTCAAATTAAGAATGGGTCTGTGATGTCACATCTAGGAGCATCTACCCATGGACAGACATGTCTTCCC
  ATGGAGGAGGCTTTCGAGCTACCCTTGGATGATTGTGAAGTGATTGAAACTGCAGCAGCGTCCGAAGTGA
  TTAAATATGAGTATCATGTCTTATATTCCTGTAGCTACCAAGTGCCTGTACTTTACTTTAGGGCAAGCTT
  TTTAGATGGGAGACCTTTAACTCTGAAGGACATATGGGAAGGAGTTCATGAGTGCTATAAGATGCGACTG
  CTACAGGGACCATGGGACACTATTACGCAACAGGAACATCCAATACTTGGGCAACCCTTTTTTGTACTTC
  ATCCCTGCAAGACGAATGAATTCATGACTCCTGTATTAAAGAATTCTCAGAAAATCAATAAGAATGTCAA
  CTATATCACATCATGGCTGAGCATTGTAGGGCCAGTTGTTGGGCTGAATCTACCTCTGAGTTATGCCAAA
  GCAACGTCTCAGGATGAACGAAATGTCCCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001131028
• ORF Size: 663 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001131028.1, NP_001124500.1
• RefSeq Size: 2432
• RefSeq ORF: 663
• Locus ID: 83734
• Gene Summary: Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (1) is the longer transcript. Both variants 1 and 2 encode the same protein.