HS2ST1 (NM_001134492) Human Untagged Clone

CAT#: SC324816

HS2ST1 (untagged)-Human heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HS2ST1
• Synonyms: dJ604K5.2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001134492 edited
  ATGGGGCTCCTCAGGATTATGATGCCGCCCAAGTTGCAGCTGCTGGCGGTGGTGGCCTTC
  GCGGTGGCGATGCTCTTCTTGGAAAACCAGATCCAGAAACTGGAGGAGTCCCGCTCGAAG
  CTAGAAAGGGCTATTGCAAGACACGAAGTCCGAGAAATTGAGCAGCGACATACAATGGAT
  GGCCCTCGGCAAGATGCCACTTTAGATGAGGAAGAGGACATGGTGATCATTTATAACAGA
  GTTCCCAAAACGGCAAGCACTTCATTTACCAATATCGCCTATGACCTGTGTGCAAAGAAT
  AAATACCATGTCCTTCATATCAACACTACCAAAAATAATCCAGTGATGTCATTGCAAGAT
  CAGGTGCGCTTTGTAAAGAATATAACTTCCTGGAAAGAGATGAAACCAGGATTTTATCAT
  GGACACGTTTCTTACTTGGATTTTGCAAAATTTGGTGTGAAGAAGAAACCAATTTACATT
  AATGTCATAAGGGATCCTATTGAGAGGCTAGTTTCTTATTATTACTTTCTGAGATTTGGA
  GATGATTATAGACCAGGGTTACGGAGACGAAAACAAGGAGACAAAAAGACCTTTGATGAA
  TGTGTAGCAGAAGGTGGCTCAGACTGTGCTCCAGAGAAGCTCTGGCTTCAAATCCCGTTC
  TTCTGTGGCCATAGCTCCGAATGCTGGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001134492
• ORF Size: 690 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001134492.1, NP_001127964.1
• RefSeq Size: 1623
• RefSeq ORF: 690
• Locus ID: 9653
• Protein Pathways: Heparan sulfate biosynthesis
• Gene Summary: Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
  Transcript Variant: This variant (2) uses a different splice site in the 3' coding region and lacks some coding region segments, compared to variant 1. The resulting protein (isoform 2) has a shorter C-terminus when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.